Dasypus_novemcinctus Locus Mono:153:SNORD113
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:153:SNORD113
Dasypus_novemcinctus
Mono:153:SNORD113
scaffold_60341
SNORD113
1001..1073
2073
GAAGGATGCTTGAGGGAACCACAGGGCAAGCCCTTTACGGGAGCCTCCTTGGTCTCTAG
GGTCCTGTTCCCTGATAGCCTCATTAGGGACAAGCAGAGAGCAGCTGTCCCTTCTCCTCG
GGTTCTTGGATCTGATGCTGATAATAAGAACCCACCATGCGGGTATGTAAGTCCTACTTC
AGGACTTGGAAACATTGGAAAGAATATCTCGGAGGTAATCATTGGTAAGCAGCTGTGTAT
GGAAAAGGAAGTATAGAGAGACTGAAGGGTAATGAGGTTTTTTGTGTGTGTGCCTTTTTG
TTTATTATTATTATTGGAATAATGAAAACGTTCTAATAATGATTGAAGTGATGAATGCAC
TTTCCTCTTGTAAAACAAATTTTCTATCATGGACACGAACCGCATTTTTTCTTTCTTTAG
TTTTCTTGTCATATAGTTTTGTTTTTTTTAACATACAGAATATATTAGTACTTTCTCATT
ACAAAAATCAAGCAATATCTAGTTTTTTTTTTTAACTTAAGAAATTAAAATATCTCTTTA
CCACCATCACCTGCAATCCCCTTCTGCCCAACAATAATTCACCATCAAAAATGTGGAACT
TTATAAGGGTGGCTGTAGAGCAATTCCACTTCCAGATAGAGGTCAGGGTTAACAGGTGAT
TGCATTTGTCAAAACTCAGCAAATGTATCCTTAAATTTGTGCACTTGAGTGTATGCAAAT
TTTACCTCAAAGGAAAAGAAATTAAACAACTATTGAACTCTAGTTGATGAAATGCATGCT
GATGTATTTAGGGAGAAGTGTACTGATGTTTTCAATTTAACATGAAATGCATCAGAAAAT
AGGATAGAATGATGGATGGATGGCCTAAATAGACATGTGATAAAAATAAGTAGAGAAAAA
TGTTAAAGGTAGAATCTGGATGGTGGGTATACTATGTTTGAATGTTTTCTTAATAATATG
ATGGAAGAAAATTATGAACAAATTCGTCCATAAAAAACATTTAGATGGATGAGGACCACT
GTGGCGTATGAGTGATGGATGATGAATACATGTCTGGATGGCTCTGGAGTTCAGTGCCAT
GTCAGTTGGCCCTACTTTGGAATTTGTATTCCTGAGTGTGATGGGGTTGGACTCAGATGT
GACCTTTCTACACATGCCTCTTCCGTCACTTTTACTGAGTGTGTGGTTGGTGCTAGGGTT
GGTGTATCCTCAGGAGACTAGAATCTCTGGACAGTCCATGTGCCAGCTGGACCCTGACCC
TCAGCAGACTTGCAATTCCTACCCTCTGGTTCATTGGACTTACCCAGGCCAGCGAACAGG
GAGGTGAAGATGATCAACCACCACACCAGGAAACCGAGAGGGCTTACAACTGCAAGCAAG
AGAATTGCATCCATCATCCATGTGGAATCTAAGTCCCCTCTCGATAAAGAGGTGGAATGG
ACATCACCATCCCAGGGTCCACAGGATGGAGGAATAAAATATAGATTAGAGTGGACTTAC
TGGTACTTTACTATGTAACTGTTGTGACTAGTAATAGAAGAAATTGTAGCACTAATGTGG
AGAAAGTGGCCAAGGTAGTTGCTGAGGGCAGGGAGAGGGAAGAAGAGATATGATGTGGGG
GCATTTTTGGGACTTGGAGTTGTCCTAAATGATATTGCAGGGACAGATGTTGAACATTAT
ATATCCTGCCATAATCCACTGAATGGACTGGGGAAGAGTGTGAACTACAATGTAAACTAT
TATCCATGTGGTATAGCAGTGCTCCAATATGTATTCACCAAATGCAATGAATGTGCCACA
ATGATGAAAGAGGTTGTTGATGTGGGAAGAGCTGGGTGGGGAGTATATGGGAACCTCCTA
AATTTTTTGAATGTAATGTTTTTTAAAAATAAAATAAAGAGATCATAGAAAAAAATTTAG
TGTTTATTTCCCTAGGTATATAATTTTGACCTGTAAAAATCAGCTCATACTGAACGAAGG
CTTTTCATTGTCTTTCACTCAACAATACATCCTCATGACTGATTAACATCAACACATAAA
ACCCCATCTCATTTTTTAAAGTTACTTATTGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved