Dasypus_novemcinctus Locus Mono:351:SNORA32
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:351:SNORA32
Dasypus_novemcinctus
Mono:351:SNORA32
scaffold_3550
SNORA32
1001..1122
2122
TCAAATTGTATGTTTTAACATATTCTTATGAAAGTTATCAATAGTATTTTACATTTCAA
ATTAATATGCAAAACAGTAGTAAAATATATGGTCTCTGGAGACAGTTTACTTAGGCAACA
ATCCCTATTCTGACACATAATAATTTTATAAACTTAGACAAGTTAATTGAATTGCAGTTT
GCTCATATTTAAAAATGGATAAAAATAGTATCCGTGTCATTTAGTTACACTGAGGGTTAA
AGCATTAATGTAGGCAAACTTACTCCCATGACATGTGGCATGGGATAGACCAGCAATAGA
CATTAGTTGATATTATTAGCTCTTATGTATGAAAATCCATATTATAGGAACTATATAATG
TCAAAAATTTAAACTGCTTGCTTTATTTTTAATTTGATTTGCATATCATAATTAATTCAT
AACTCTATAAGACTAAATTAACAGTAAATATCTTCTTTTTTTTTTTTAATTTTTTAATTT
TTTATTGACTTTGTAATAATATTACATTAAAAATATATATGTGAGGTCCCATTCAACCCC
ACCCCCAGTAAATATCTTCTTGACTTGTGATATTGCCAGAGAGGACACAGAATTCTGCTT
CTATGTCTTCTGGTATTGAGTCCATGTTTTTAGTGTTTTTTTTTTTTAATATTATGCTTT
AAAAACTTCACTCTGGGTCCATTTTATTTTTTTAAGTCTCTTTCAAATAAGAAAGCAATT
GTGTTCTGGAAACTGAGAGGATATCAATATTCACATCATGATTTTCAGTAATTTTTTTTC
TGTTTAATGGTAATGAAAATCAGCATCCTTTGTGATCTGAGCCAAACTCTGATGGAAAGA
TGTACATTTAATCAAATGTATCTTTGCTTTGGATATTGCAGGTAGAATGCTATTCATAGA
TTAAAAACATTTTAAAATTTTAATAAAACAGTAAGAAAAAATATATTTGGTAGATTTTAT
AGTTCAGAGTTTTGTTGAAAATATCATTAAAATCTACCGAATGGTCATTATAAAGGTTTT
TAGAATACACTGTCTGATTTGCTGAGGAATTGACAATAAAAAAGCCTTCCCCCTAGGTTT
TCTTTTTGCTACCTTGCTAGCATTCAGCCTATTGGGGATATTTTATCTCCTTGTTTTATT
TCAATACACTCCTTGTATCAGCACGGATAAATAAATAATGCAAACTACATGTAATTTTCT
AATATCATGTTTAATCAATACGAGTTTTTTTTTTTCATGCTATGTCTTTGAAAAAGGCCT
AGGCTGCTTGCAAATGTGGTTTACCTGGCTAATCCAAAAAACAGTCCTTCTGGGTTGCCA
CTGACCACGTATTATGTAGTAGCGCTAACAGAAGAAAGCTGGCTCCAGAACTCATTCCTT
GAAATAACCTTTATGTTCCTGTTATTCTGTAGGCCTGACTGAAAACAGTAGGATTCTTTT
TAAAAGAGCTATCTTGAAGATAAATCTGGTTTCAAACTGAAAAGGAACTAAGTTGACTTC
TATAATTAAGCAGTGGAATGACCACATGTTGAATTCTATAAATAAAAATTTATTGATTTA
TAATATGCTACACATAATAAAAATACTTGTTACACTGTAGAAAATCAGAATGTATTTTTG
GCTCAAAATTTCTCTAGTGTTTCTGTAGAGGAAATAAAACAAATTTAGCAGTTTCAAAAA
AACATCTGCAGAAAACTATTTCCTGCCTTCCTCCCATTTATTAACGCCTAATAAACTTTT
ACTCTGTTTCTACTCTCTCTGTACCACCTCTTCGACTCTAGGCAGGACTATCACTCCTTC
TTTGCCTCTGTATGATTAGGTGGAAGCAGCTGGAGTCCACAAGTTGCACTTGGCAATGGA
CCTTAGTCTTTTCCTTCAAACCAGTCCGCTGAATTTATTCTTTCCTCTACTATGAATTAA
ATATTGGACCAGTTGTAAATATTGTCAAATGCCTTTCAAGTAATAAATATTCCTTTTGCT
TCCATATTAAAAAAAAAATTGCAGCGCAATCTAAATCTCACACAACTCTAGTCCAGCTTC
AGGGTATTGCATTCACTGCTCCCTTTGCTCATAACACTATCCCCCAATATTCAGGCAAGT
CTCTGCTCAAATGTCACCATCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved