Dasypus_novemcinctus Locus Mono:209:SNORA30
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:209:SNORA30
Dasypus_novemcinctus
Mono:209:SNORA30
scaffold_97518
SNORA30
1001..1128
1639
TTGATCCCTGGTACCTCAAAACAGACAAACAAGCAAACAAATGAAGAAACTAACTGTCA
TTGGGGAGTGGATGTAGCTCAGTGGTTGAGCACCTGTTTCCCATTTATGAGGTCCTGGGT
TCCCTGGGTTCAATCATTGGTACCTCCTAAAAAAAAAACAAAAGAACGTGATACAGTACT
GTATCATGTGTACTGTAAGTGCAAATTAACTCAGGACAGGAATGCCTACTGATGACTACC
ACTAGAATGGGGACTAAAAATCAAGCACACATAATGATGATTTGTTGAGCACCTACTGGG
TACACAGTACTATGTACTTTACATCTTCTATCTCTAAACATCAAAATAATACTGCAGGGA
AGATATTATTCTCATTTTACAGATTAGAAAACTGTGGTTCAGAAGGTTTAAGTAACTGGC
ACAAGGTTACACAGCTAGCTAGCAAAGAGAAGAGGCAAAATTCATATCAGCCTACCCGGT
GTGACTTCAACACCCATGTGCTTTCACTCAGATAGCCACACTCTAAAGCCTCTTTAACCC
TTAAACATAAAAAGGCATATCTAAAGCAGAAAATAAAGAAAAATAAATAGAATAAAGAAA
AATTTTAAGAGGAAAAGTTGCATTCAATGGGGAAAGTTGCAGAGATCTACCACTAAGGAA
TCCTAGGATTAAAGAAGGCTTCTGGTAGAGAGTAGAACCTGAGCAGGACCTTGAAGAATT
GGTAGGATTTGATTGTCCAGAAAGGAAAAAAGAGAATTCTGAAAGGAGAATGTCTTGGGT
AAAGATTTGGTTCCTGAGGAAATTCTCCTCAGCATTTTGAGAAGACCATGACCTTGACCC
ATTTAGCTGGGAAGGAAGAAACAAGGAAATGAGGTTGGGATGACATAGATTGCAATGAGT
TCAAAAATAGGTCCTGAATGCCAGCTCAATAGTTTAGATTTCACTCTGTGTAAAATTAGA
GGATTTTAAGTAAGGATGTGACAAGATTGAAACTGTATTTGTTAGCACTTTCATAGGTCT
TCCCCCAGGCTGTGGGGCCAGGATTGGTAGCTGATGCTGAGAAAAACCCTTTGGGTACAT
CCTTGTCCTGGGACGGTTCCAGTGACAGCTGTCACTCAATGGGACAGAGAGAAAAAAAAA
AAAAAAAAAGAAAAGAAAAAAACAACAACAACAAAGAAAAAAAACTGGTATTTGTTGCCC
TAGATCTTGTGATATTTTGCCCAAGACAACATGTAATCATATACACACAGAATACAATAA
TTAAAATTAAGTTGAAACATGAAAGAAAACCACTTCTCTTTCATCTACAATGAAGTTTCC
ATGGTGACTGGAAATTAATTGAAATCTAAGACTTCCACAGTCTATAGTAGAAAAAAAATT
ATTTAATCAAAAAGAAAAAGGAAATTACAGAAGCACTCTATTTAAACGTGCATTTCCTCT
TTTTAAAATCTTATTTCCTGTTACTTAAATGTGAAAAAAAAATTGAGAATGGGAGAATTT
TAGTTTCTAAAGGCTGCCAATGCAATATACCAGGAATGCGTTGACTATTATAATGGGACT
TTATTAGGTTAAAAGCTTACAGGTCTGAGGCTGTGAAAATGTCCAAATCAAGGCATTATC
AGAGATGCTGTCTCACTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved