Dasypus_novemcinctus Locus Mono:276:SNORA3
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:276:SNORA3
Dasypus_novemcinctus
Mono:276:SNORA3
scaffold_2176
SNORA3
1001..1146
2146
TCAAAATTAACTGCAGCTCTGAATTTATTTCCCATAAACTTATAGTAATTATACCATCT
ATATATTTTAACTTAAAGAGGATTGATATTTTGTGTTACAGATCTATTGATATTTAAATG
ATGCAGAATGTTACTTGATAAAATCATCTTTCTTCTTCAAACTGCTTGCAGCCATGTTAT
TAGCCCATTAAAGCAGATTTTTAAAATAAATACAATGATATATAAATCTCTTCATGCAAG
AGTGCTAATTAATACTTTGTATGTTATAATAAGGCTTACCGAGTCACACTTTCATTGTAT
AATAACTGTTTAACATTTAACAATCTGAATTTAATCCATGTTTTATGTTACTCCTCTTTG
GCAATGATACAACCATTATCACAGATATGGGAATATTTGAATGTATTTATTACTTAAAAT
TTTCATATTGGCATTATACCAATAAGTATATTTATAAGCAGCTTAAAGGGACAAATTGAA
AATTATTCTTTGCTAGATTACCCTTAGGGTGAAGTTTAATAAATGTTTGTTGAAATTCAA
ATCAAATATTTGAAAAGAACCATAAAAATACCACTCATTATTTACTTGTCCTATGTCAGG
TATAGTTATAACTCATTTTTAAACACATCACCTTATTTAATTCCTGCAAAAACCACATTG
AAAGAGATATTTTATCATTCCCTTATAGATGAAAAAACAAAAACAAAAACAAACCCAAAA
CTCACAGAGCATATAATTTCCACAAGCCCCACACTTAGGAAGTATTGGTCCTGGGGTCCT
GGTCTGTTGGATTGAAATCCCAGGCTTTGAAACTCTCAGTTGCTTACCTAAGGGGTAGGA
TGGAGAGCTCGATTTTTAAAATGAGCAACATGGTATTTGATGGTGCCGGCATGACCCTCA
TGCCGGTCAATAATTATAAGCTGCCAAGGCGAAGCCACGCTTTCACTGTATGGTTGAAAA
GCCCCATTCAGATCTTCACACTTTCTTTAAAGAAATGTTTGTCCGAGACTAGAATCACAT
GCTGACACAGCTCTTGTCCTGCTGTGCTAGCGTCCTTGGAGACAATCTGCTGATCTTGAT
TCACTGGTGGGGGTGGGGAGTGGGGCGGTGATTAGTGCCCCTGCCAGTCCCCTGATCAGA
AACATTTCTCACCGAGCTCCTAAAAGGGTTACTACAAAGTTCTGGGGAAGGGAAGGCTTC
CAAAGCAGCCCGTCATCCTGAAGGCCAAATTCTTCAGCAGAAGAGCTGAGGAGAAGATTA
AATGTGTGGAGTGACCCTGTGTCCTGGTGGCTTGAAGCCTTATGGAGGGAGGTTCAGTAA
ATGCTGACATGCTTTCCCCCCAAAAAAAAAGAAATGTGTTGATGCAACTTAAATTTTGTA
GGGCCAAGCCCTCACCATACAGTTAAAAGCCAGGACGTTCACAATCTCCAAAGATCTTTA
TGTTGAGAAAAGTTGTTTTTAATTGGGGGGGAGGGGAAGGGAAGCAACTTTTGCAGATTT
CAGGCAAATACCCAATGGGAGAAATTGGCTGAGTCCACCAAGCAGGTGGGTGAAAACCTC
ATTTACCATCAGCAAACAAATGGAGAACTTTGAAGACAAGGCAACTAAAGACCTTAAGGA
AGGAGACAGAAAAGGCGTCTAAAGCTAAGTGTTAATAAAGAGAAGTGACTAACTGCATAT
TGGTTTCTTCTGCAAAGTAGTTTGGGGACCACTGTGAGGAGAACCAAAACCACAAGTGAG
AAGGGCTTTCCTTGAAGAAGCTTGGCCTCCAGGCCTCTCCAGTAACAATGCTACAGGTAA
AAGATTAGGAGTCTTAACAGGAAGGAGGCTTCAAGAAGGTCTATCCAAAAATCTTGGTTT
TCCTTAGTATGTTATTCCAGCTATGTCCTGTCTCTGATATAATACTCCATTATACCAATA
AATATCTACAACCAACTGCCTAAATAAGTGTGAAACCACATCTGAAAGAGTCATTGTCCT
CTTCTCACCCATCATAGGACCAGCATTTGCTACAGTGTAGAGTAACCTACCTGAAGATGG
CTGCATTTTTGCTTTTTTAAGAATTAGTGCTAAAAAAAATGAATAAATAAGAATTAGGTC
TGACTGCTTTCAGATAAGTCTTTGCAAAGATCTCTTGACTCCAAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved