Dasypus_novemcinctus Locus Mono:59:SNORA46
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:59:SNORA46
Dasypus_novemcinctus
Mono:59:SNORA46
scaffold_19872
SNORA46
1001..1140
1960
TATTCTTGAGTACACATGGATCATTCTCCAGGGTAGACCGATATCTTAGGTCACAGAAC
AAGTCTCAGAATCAAAACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGAAGA
AAAGGGCTTAAATCAGATACCTTACCTCACACCGAGAGTATCTAAAAAAAAAAATAAAGC
CTCTTAAACCCAAAGCAAGCAGAAGGAAGGAAATAACAAAGATTAGAGATGAGATCAATG
AAACAGAATAAAAAGCAATAGAATCATCAAAACCAAAAGAAGTTTCTTTGAAAAGATCAA
TAAAATTGGCAAATCTTTAGCTAGACTGACAAAGAAAAAAAGAGTGAGGACACAAATGAT
TAAAATCAGAAATGAAAAGAGGGACATTACTACTGACCCCACTGAAAGAAAAACGACTAT
AAGAGGGTATTATGAACAACCATATGTCAACAAATAAGGTATATATGACAAATTTCTAGA
ACCATACAAACTACCTACACTGACTAAGAAGAAATTGAAGAGCTCAACAAATCAATAACT
TGTAAAAAGATTGAATCACTTATCAAAAACTTTCCAACTAAGAAAAGCCAAGGACCAGAT
GACTTGAAAAGGGAACTTTACCAAACATTCCAAGAAACACCAGTCCTACTCAAACTGCTC
CAAAAAATTGAAGAGGAGGGAATACTCCCTAACTCATTCATAGAAAGAATTCATAGAGGC
CAATTGCACCCTCATACCAAAGCCAGATAAAGATACTACAAGAAAAGAAAATCAGAGACC
AATATCTCTTATGAATATAGATACAAAAATACTCAAGAATCACCACTATATTTAAACCCT
GTGGATAGGAATTTTCCTCATTCTTGATTATGCTGCAGTACAAAATAATTCCTTGGCTCC
TTCCCTTGCACAGTTGACTATGTGCAAATTTGCTGTTCCTCTGTGGAATTAATAAACATG
ACTATATTCAGCTTTTATTATCTGATTTGATACTAAAGATGAATTTGGATACATGAAAAT
TTCCAGGTATTCTGGAGCAAAATTTCAAGATCCCTTTTTAAACAAAAAAGTTAAGTAGAG
CCATAAATAAGAGGTATTACCTAGCAGGTGTGTGTGTGTATGTATGTACATGCACCAAAG
AACTCTCCTTTGATATATTTTTTTAAAGATTTATTTATTTATTTCTCTCCCCTTCCCCAC
CCCCCTAACCCTAGTTGTTTGTTCTCTGTATCTATTTGCTGCGTCTTCTTTGTCCCCTTC
TGTTGTCAGCGGCACAGGAATCTGTGTTTCTTTTTGTTGCGTCATCTTGTGTCAGCTCTC
CATGTGTGCAGCACCATTCCTGGGTAGGCTGCACTTTCTTTCGTGCTGGGTGGCTGTCCT
TACAGGGCTCACTCCTTGCACGTGGGGCTCCCCTACGCGGGGGACACCCCTGCGTGGCGC
GGCACTCCTTGCACGCATCAGCACTACGCGTGGGCCAGCTCCACACGGGTCAAGGAGGCC
TGGGGTTTGAACCGCGGACCTCCCATGTGGTAGACAGATGCCCTCACCACTGGGCCAAGT
CCGCCATCTCCTTTGATATTTATGTCCCCTTTAGGAAAGTAAGAAGTAAAGAATTAAGAA
AAATACCATAAGACAAATTCTGTCAGTGAAATGGATTGGGTTTTCTAGAAGTAGGAAAAG
AAGCGTGTACGCAATATTATTTCATATTTAAGAAAGTTGTATTAATTGTCTCCAGAGATA
TATAATGACCTGGATAATGCCAAAGATGCAGAGGTAGCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved