Dasypus_novemcinctus Locus Mono:160:SNORA2
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:160:SNORA2
Dasypus_novemcinctus
Mono:160:SNORA2
scaffold_64916
SNORA2
1001..1124
2124
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGACTG
GCTTCCTCTGCTCTGCGAGGTCCGTGAGCCTATCCCCCGCCCTTAGGTCACCTGCATCTT
CCAGAACCGCTGGGACACCTCTCACCCCTTACTGCCCCCCCCCAGCAGCCTTTGACCCTG
CTTCTGGGGGAGCAGAGCCGTGAGGCAATGTTTACCCACAGCCTGCCTTTTCCCTGGGGG
GCTGAGAGAGGCCGAGGCCCCCGATGTCCCCCAAATGCTCCTCCCCCCGCGCCAGCTGTC
TTGTCTAGGGTGCAGCCAGTAGCAGGCCTGGAAGGGCCCTGGGGCATGCGCGCTACCCTT
GCCCTGCCCCAGCCTTGCTTTTTCTCCCTGACACCTTGATTGTTGCACGTGGGTTTGAAG
TATAAGATGCATGAGTCCTTGGTGATGTACCAGGCGGGGAAAGCATCTGTGCAAGCAGCC
TGGGTTCCAGAAACCAGCCCCTGCCGGGCACCCCAGTCCCCACGAGCCCCAACCCGCCTA
GTCCCTGGCCCCAGGGGTCAGCCCTCCTGCCCTCCAGCCTCACAGGCGCCCCTTGCTGTG
CGCGGCCGTCCCCCTTCCCACACGCGGCTGCCCCGTCCACGGCGTTGACCGTGGACCGTC
ACAGCGTGCTCAGCTGGCCTGCCAGGACCGGCCCGTCTTGGCTGGGAGAGGGCAGTTGGC
CCCGGGCTGGGCCAAGCAGGTTCCTAAAGAAATGTCTTTCTGTGGTCTGTTGGCCATTTC
AGAACTTTGGAAATGTTATAGTCAATTCACTAGAAAGTGATTGGAAAAAAAACCCAGAGC
TGTTGAGTGCGTTTGTAGCACCAGGCCAAAGCATCTTACAAGCTCTAGTGTTGATTGATT
AATCATCAAAGTTGTTTAAAAATATTTAAATTTTTAGATGTATTGATATTTAAAAAGATA
ACAAAACAAGAGATCCATTTGGGGAAATTTTGCCTCCAAAGTATATTTTTAAAAGTTCAG
ATACTTAAAGTACTCTGAAAAATTCATTATGAGTGACAGATAAGTGAGACATTATTTCCT
CTAGTTCTAGAGACTGGGAATCATTTGTCTCTTAGGACCTTCCCATTACTTTTTTTTTTT
AAGATTTATTTTTTTATTTTATTTCTCTCCCCTTCCTGCTCCCTCCTGCCCCCCCCCCCC
AGTTGTCTGCTCTCTGTCCATTCGCTGTGTGTTCTTCTGTGTCCGCTTGCATTATCTGGC
GGCAGTGGGAAACTGCATCTCTTTTTTGTTGTGTCATCTTGCTGCCTCAGCTCTTCATGT
GTGCGGTGCCACTCCTGGGCAGGCTGCATTTTTTTTGCATTGGGCAGTTTTCCTTACAGG
GTGCATTCCTTGCATGTGGGCTCCCCTACATGGGGGACACCCCTGCGTGGCACGGCACTC
CTTGCATGCATCAGCACTGCATGTGGGCCAGCTCACCACATGGTCAGGAGCCCTGGGTTT
GAACCTTGGACCTCCCAAGTGGTAGGCAGATGCTCTATCAGTTGAGCCAGATCTGCTTCC
CTCATTACTTTCTGGAGAATGTACAGTAGCCCCTAGCTCTTGGGCTTCTGAAGGTTCAAG
CTGGAGCCTGGAGAAGGACTGAGGGTCATGGCTCTTGGTTATATGTGAATGCAAAGCACC
AAGGCTTCTGGAGTAGACACAAAAAGTCAGAAAATAAAGCCTTGCAGACAAATTACTAAG
TGTTGGGATGGTTTCAAACCCAGAAAACTGGACTTAAACAACCTTTGGTATAATCTTCAT
CCTCTCTTCTAAGAGGCCCTGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved