Dasypus_novemcinctus Locus Mono:66:SNORA57
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:66:SNORA57
Dasypus_novemcinctus
Mono:66:SNORA57
scaffold_23945
SNORA57
1001..1151
2151
AAGGTTGAAATTGGTGGATCTGGATATCTGAGGAAATAAGGGCATGTTGGAGTTCTCTG
TATAGGGTTTGTATTTTTGTAACTGTCCTTTAAGTTTGAAAGTATTTCAAAATAAAAAGT
TAAAAAAACAACAACTGTACTCCAGGGCTGGGGCTAGGGGGAGGTAAGAGGGGCATCTAG
GGTACAAAATGTAAGAAGGTGCTCACTCTCATGCCGGCCCTGCACTGGCGGGACCCGACT
TCCTCCCTTGCCTGCCCCTAGTCCCAGCCTTGCGGGATACACCTTTAAGGGCAAGGACTG
TAATTTCTAGATAACTCTATGATGCCTCTCATGGCATTCACATGGCGCTAGGTAGGAGCA
TGTTTTGAGGATCACTAGATGCATATGGATGCTAGTGAACAATGGATTTCTGACAATAAA
TCTGTATCTATACAGATGTTTGTATCTTTGGGTAAATATAAGTTAACAACAGAACAAAAT
GGGAAAAACCCTATACTGGAGCCTAGAGACTTGGATTCTGGTCCCCTCTCTGCCACTGAT
TTGCTGTAGGAATTTGGGTAAGTTGTACCCCATCTCTATGCTTTAGTGGAATGAGGTGAT
TGAAGTAAATAACATTTATTGTACACATACTCTGTGCCAGCCACAGCTTAAAATTTTTCT
ATATTTTAACTCATTCAAAGACTTTCTGGCCTCTGAGGTTCTTTTCACTTGTAACAGGCT
GTGGTTTGAGGTAGGGAAGGCTTTGTGGAGAGTGTGGATCTTGAGGTGGACCTTCAAACT
CTCACTTGGGTGTTAATACTTTAAATCCTAGTGTAAAGGCATGGTCTCTCGAAGCACTTC
TGAGCCACACCTAATCCTAGGATTTCCACCACCAAGACTGGGGCCAGGCCAGCTGCCTCA
GAATCACTTTTTGAGCAGGTCAGAAATAAGTTCTCAGCCTCTGGCCCCAGCAGGGATTCA
GAAGAGGGTCGCAGGAATCTGTCTTAAAAGCTTCTCAGGTTACTCCTTTCCTTGGCAGGG
GAGGGCATGCGGTCCCCGTCCTCATTATGTACGGAGGCAGAGGGAAAGGGCTCCGGCCCC
TTTGGCGTCGTCGTGTCTTCGGTGCTGGCATCTTCCCATCCTCCGGCTCTGTTCTCAGTC
ACCTGGTCTCGGCTCCAAAGAGCAGGCAGAACCAAGGGTCCAGCGGGCTCCTCCCCAGGT
GCTTACGGCTTCTGTTTTGATTTCAGGTTTCTGAACTGTGGCCCAGGAGCAGGAGTTGAC
TGACCCCCTCCTGTCCTCTACTTCCCGTTACAGTAAATAAATCAGGACTGTTTGTGCATG
GTTTTGTTTTGTCTTTTGTTTTTTAAAAAAAGCTTCTCGGGTCATTCTGGAGGTCAGTTT
GGGAACCACTGATCCACGGAGACCAGTGCCTTCTCTCTCTATGGACGGGATCATAACTGG
ACAGCCCAGACCAGAATTGCCTGGTCTGATCCTAAGTGTCTCTGAGCAGAGAAACAAATG
CATTGATTAATTTCCCCAGCAAATACGAAGAATCTCTTGTGTGCCAGGTCTTGCGCCAGG
CAGTGATTATGGTCCTTGTCCTGAACGGACTCCCATTCTAGGTCTATCATTCATTTTAGA
AGCAAGTCCTCCAGTCTGAGCCCGAGGAGCCTTAGAGACTATCAACCGATCCAGTCATCA
CACAGTGGGAAAGCAATGTGTTCAAGAACACGCAGCAAGTGGCTGATATAGATATAAAAC
CAATGTTCCTGGAGTCTGACTTCAGTTATTACTGAACTTTTACATTTTCACTCTCTTCAA
CCAGAACGGAGGCAGGGAATTAGAGGGCATGCCACGCCGGAGTATTTTTAAACCCCAGGA
ATAAGCGCCCCCTAGGACTTGGTTCCGTTCGACTTAAATTCCTTGCCCTGGAAGTGCCCG
CGAGCGCGGCGCCTGCCCAGCCTCCACACCCCTACCCTTCAGGGCTGAAAGAAGCGGGGC
CGCCTGCGGGGTCCCGAGGACCTGGCTCCGCGATCGCGGCCCAGACAAGCTGCTGCCCCC
GGCGCGGGCGACCGGGGCCGCGGAGAAGCGAGCGCTCGCCGAGCCCGCCCCTGACAGCCC
AGCCGCCCTGCGATTGGCCACAAGGGCCCCGTCCTGGCCGCGGATTGGCCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved