Dasypus_novemcinctus Locus Mono:87:SNORD24
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:87:SNORD24
Dasypus_novemcinctus
Mono:87:SNORD24
scaffold_32251
SNORD24
1001..1067
2067
AGAATTTATAATCCAGAGTACTAAAAAGTTAAGACAATGATCTGAAGAATATAATTAAT
AAGACTGAATTAATGAAGAATTAGAACACATTAAATGAAAACAGAATGTTTCCTTTTTTA
AAAGAAAGGGACTATAATAATAATTTATAACATACTAAATGCCATTAACTATAGAAAAGT
AATGATTACAGAAGTCAATTTCTCTGATGACAATATAATAAACATGTTAATATCTGGGAT
GATGGGAAAGTTTTGGTAAGGGATGCAGTGATGGCAGCACAGCATCATGAACGTTACATA
ATAGCACTGAATTATATATTTGAATGTGGCTAAAAGGAGAAATTTTAGATTGTATTTATT
AAAAATTTTTAAATAATGTGTACTAAAAAATTCCATTAGCTTAAATGTCATCATAATTAA
GAAAGAAAACAAGAAATTGTGCAAGCAATAGTCAACAGAAAATACCAAAAGCAATAACAA
AATGGAAAATGGGGAAAAGGAGATAATAAAAGTGAAGGTAAAATTAAAGACATTAGAAGA
CGAAATCATCCTAGTGGTAAAATTAAGATGTTTCTTTCAAAAACCTAACTTAAAAGAAAA
TCCTGAGATAAATTATAATCAAGAAATGGAGAAAACACAAATGCACTTTAAAAATGAGAG
AAAAAATGTACAAGTCAGAGAAAAAGTTATTTGAGAATGCTATGCAGTTTTATACTGCTA
CATGGTTTAACCTGAGGATAATTTAGGATTTTCTATAAGAGTTTAAAGTATCTAGCCACT
AAGAAACATAAAGTTTGAACAAATCAATAATTGGGGAAAAACAAGCAATTTTCAATAGGA
GAAAAAACTAACTATATCCATTCAGATATAATCACAAACACCCTCCTGGATAGGAAAGAT
CTATAATGAATTTTAAACTTACGGATTTTGCTAAGCAGTACAAAGCAATCCTAAATATAG
GCAAAGAAGGCACATGATATACTTTATCCTGAAAGATATTCTGCAGCAAAAAAAAAAAAA
AGCTTAATAAGAGTTAATATATATTTAACCACCAAGATCACTGAAGCATGGGGGAGAAAA
AAGAGTTATTAATATATAAAAAAGGAAGTCGTTTCATCTTTGAGTATAGGTAAAATATAC
TTAACACTATAGTAGTCCACAAAATAGAACCTTTTTTAAACAAAAACAAATTTAGGGAAG
CGGACTTGGGCCCAGTGGTTATGGTGTCCGTCTACCACATGGGAGGTCCGCGGTTCAAAC
CCCAGGTCTACTTTGACTCATGTGGAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCGGGGCAGGGGTGTGGGGGGTAAGGGGAGAGAAATAAATAAATCAAT
CTTAAAAAAAAAAAATTCATATATATAAAAGGAGGAAGTGAGGATTTAGCTGCAGCCTGA
GTCTGAAACATAGCCTTAGGGGTTCGACTTGACTCCCTAAGTTCCAAATAGTAACATAGT
TCATGTTAAATGAGCACATACTCTGTGGGCCACTATTATATGAGACGAGCCAACCATTCC
ATGTCATCCTCCCAACAACCCCGTAAGGTAAATACTATAGTACTTCCTTTTTACAAATGA
GGAAACTGAGGCACAGAAGGCACTAGAACCCAACCCAGGCCTGCTGCCTCTCCTCACCAT
TGTGCTGTTACTAAGAATGATATGATGAAGCATCCAAGAGCTAATCACATCCCAGGGATC
TAGGGAATTTATCGGCTGAATCATAACTGCATTCTATTACAATGACATTTTTACATGACC
CCACTGTTTTCCCACAACTCCTCAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved