Dasypus_novemcinctus Locus Mono:415:SNORA7
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:415:SNORA7
Dasypus_novemcinctus
Mono:415:SNORA7
GeneScaffold_5425
SNORA7
1001..1140
2140
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGACAACAGCTGAGTAACAGACCTACACAGAGCACACAATCTAGTCTTGG
CAGGAGGGTAGAGGACTCAAAGGAAAAAGAAAAAAATGGAACCAATAAATTGATGATTTT
TACTATGTGAAAAGTTGGAAAACAGCAGTGAGATGCTGCCAGAGATGCATAAAAAAGCAG
ACATATATTTTTTAAAAATAATAAAAAGGTAATTATTAATTCCAGGAAAACAAAGATTGT
TCAACCAAGAGGATGTAACCTCAGTTTAATATGTGCATTGGCACCTCCCAGGATCACGTC
TGGAGAATGGCTAGTATTCTACCAGCTTCAGAGATGGGAGGGAAAGCAAGAGTGGCAGAG
ATGCCCATTCCATTTCCAATTTCCTCAGTAGCTGGTGATTGGAAGATACTCTGCGACAGT
GTTCAAGCCCTAGGAAGGAAGGCCTTCTTCCAGGACTCTTTCTTAGATGTGTTCTGCCTC
TTTCTTGAAGGCATCATGGCTGCCCTCAGACCCCTAGTGAAGCCCAAGATAGTCAAAAAG
AGGATCAAGAAGTTCATCAGGCACCAGTCAGACAGATATGTCAAAATCAAGTGTAACTGG
CGGAAACCCAGAGGCATTGACAACAGGGTGTGGAGAAGATTCAAGGGCCAGGTCTTGATG
CCTAACATCGGTTATGGGAGAAACAAGAAAACGAAGCACATGCTACCCAGCGGCTTCCGA
AAGTTCCTGGTCCACAATGTCAAGGAGCTGGAAGTGCTGCTGATGTACAACAAATCTTAC
TGTGCTGAGATTGCTCACAATGTTTCTTCTAAGAACCGCAAAGCCATGGTGGAAAGAGCA
GCCCAGCTGGCCATTAGAGTCACCAATCCCAATGCCCGGCTACGCAGCGAAGAAAATGAA
TAGACAGCTTATTTTCAAGTTTTGTGTGAAATAAAACCATAAAGAGTAAAAAAAAAAATG
TGCATTGGCAATAAGCAATATTTATATAGACTTAATATAAACACAGAATATTTATTAAAC
CTCAATTATGGTATAACTACATTGAAAGGATTGGGGTAAGGAAAGTGTAGGAAAGTTCAG
GAAAGACAGGCTGTAAAGAAGAAAGAAATCCTCTCAAATATCATATTCTTTTTATCAATT
ACATCCTTCCAAACTTAAAATGCAAAGTTCTAAGCCACAAGCTAGTAAAACTTTGATTAC
ATACTGTCAAACTATTACCATGTTATTGTACCAGAAATTCTTTTTAAAAATAAAGGATAA
ATTGGACTATTACTAGGATGTCAAATTGGACAAAAAGAAAGAACTTAGACGTGAAATTAA
TTTAGAAAATTTCTCTTTCTGAATTTGCACAGCTTTTTTCCCAAAAATACTGTAAAATCT
TTACAAACTTTTCAGAGTACAGAGAACAAATCATATTTATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved