Dasypus_novemcinctus Locus Mono:54:SNORA72
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:54:SNORA72
Dasypus_novemcinctus
Mono:54:SNORA72
scaffold_18856
SNORA72
1001..1134
2134
CAAAGTGCTGCATAGGCTATTCCCTCTTCTGTGAGTTCTTCTTTTTCCATATCTCACAT
GACCCCTAGTATGATTAGGATACTCCTGATCTTTTTAAAGATATTATCATCCCCAGTGAG
CCTTCTCCATCATACCATGGCGTTGAAATTCTTCTGTGCTGCTACTGTATGCTTGAATAT
ATTCCACCTATTGCTTTTATACTCTAGGTGTTTTCATGCTTACATTCTTTATTTCTTTTT
GGACATTCTATGCTTTTCCATGCACACAGTCACATAGTATAGAAGACAGTTTTTAAGTTA
AGGGATGATCATCAAATCTTCCATCTAATTTTCACCAGCTGGACCTGTCATTTGATGTGA
AACTGAATATATTAGCTATATTAATTGAGAGCTGACTACGTGCCAGGTACTGTTCAACCC
AATTTACATTTTACATATGTTATCACTATAGTCCTCAGAATAGCCCAGTAATATGAGTAA
TGTTATCCTCTGAAATATTCTGGATTATAAAGATTCACTGAAATTGTTTTTTGAACAGTA
TGGTATGCAATATAAATGTGAATATTAAAACATCAAAAAAGCATTTGCATACCTGCAGCA
ACTCTGATAAATGTGTCAGATCCTTCAACATTGCCTCTCATTCTATGTACTGTGATGTTA
TATATTCCACCAGGAGTCATATCTATAACTGTTGCTCAGTAATCATTCCCCAGATAAGAC
ATTCCTTTGCAAATGTTCTGTTTGATATATAAATTTTGTAATGAGGGAAGTTGCTTTTGG
TTGGATTCCACATTCAATTTGCAGAAGAGGTATTCACAGCTTTTAAGGTTAAGCCGGATA
TCCTAGATGATTCTACTGAAAAGATGAATTATATGCAAATAAAAATTGCACATATATATG
GAAGAAAATAAGGCAAAACACGATAATATAAACTTCAATGCAATAATCCTTGAATTTATT
GATGTATAATGTTTTACATGCTCAGCTTTGAAAATAAGAAGATGCGAATATTCTCACTGC
CCTGATTTTGTGATAATCAGGGTAGGCTAAACATTCGCTATAGTAAAAAACATGTATGTG
TCCCCAGACCTAATTTTTTTCCCTAGGGCTGGTTTTTAAAATGCTGGTGATAAACTAAGC
CTGATTTATTATATGACCATCCTGTATGGGAAATGACTGTAACTCTAGGTATCTTTGGTC
AACCTTAAGAGATAAAGCAACTACAATAACTTTGAAAATAACCAGTGTTAATTTTGCAGA
GTTATTTCTAAAGAAGGGAAAATTCGTGATTACCAATTGCCATTAATGAATTGTAAAACT
ACTCTGTTATATTGTCTAGGTGATTCTGATATCATTAGAAGCATGTCAGAACAGACTAGT
AAAAAGTAAATCATGTAAAAAATTTTCTTTAATAAAATTAGCCGAGCTTGTTTTAAAAAA
AAAGAAGAGGAATAGGACATTATGTGTGGGTGTTAAGTAGCACCATAACATCCTCCATAA
TCCTCAAATTCGGTCTCTTAATGAATCATAAATCACTCCAAATAAAGTCATTCCTTTAGA
CTAGTGACACCTGAGTGCTTGAAACCAGAAGTATCCTTATACAATATAATCACAGGACCG
TTAGCTACCATCTGTTGATAACTAGATGCAGAATGCAGGTGGACATGAGTAAATAAATTA
GAAGGAGAGCAAGGACCTGGAGTAAGGTTACTTGCTGGGGTTATTCTGGTTGAGTCAAAG
TCCTTTGTGTTCCTATATCCCTGTATTTTTCATCCACTCATTGATGGAGTTTAATACTAT
CTTTACATTATCATTTGCTATCCTCAAACTGAGAAGAATTCAGCAGACTTCACAAACTTT
CCCAGTCATAACAACTTCCCTTACGCCAGTCTACTCCAAGACATTATAAAACTGATTACA
ACGAATTTACAAGCAATAGAGAAGAAAATATAGTAGTGTTCTGCTATGAAGCCTCTAGCT
CAGTGACAATGAATTTATAAGCAATAGAGAAGAAAATATAGCAGTGTTCTGCTATGAAGC
CTCTAGCTCAATGATTTTTACTTATATTGATATGTAGTATGTATTTCATATATATTACAT
ATATAAAGTGTGCATATGTACATATATGCATACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved