Dasypus_novemcinctus Locus Mono:122:SNORA31
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:122:SNORA31
Dasypus_novemcinctus
Mono:122:SNORA31
scaffold_44318
SNORA31
1001..1127
2127
AGATCTTTGTGCTCAGTGAACATTTCTTTCCCGGGCAGCTCTCACCGCTTTGAGTTAGT
TGCTGAAATTCTGTTGTAGAACACTCCATCATCCTTTGTTGTTCTGTAGTTTATGGGGTT
CGTCTTGATATGCTATATTTCTGTATTAATTAATGGTCTAATTCTGGGTATCTTATTTGT
TTCCCAAGTTCTTTATTGGTGAAAACATGAATCCAGATGGTATGGTTGCTCTCCTGGACT
ACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAGA
AATGTGTAAGTATGAGTGATTCTGATTGTTTCATGCCACTGGAATAGTAGAATAGCTCCT
ACAGCAGTTGCTTTTTAAAACATGGATCTAGGATCTAGTTTTTTATCTTGGGGAGTCTAA
AGAGTGTTAGGCTTCACATGAAAGACAAGTGCAGAAGGGCTTGGAATCTTATTTATAGAA
AAGCCTTTGAATGCAGATGGCATTATAAAGCCACCTATAGTGGAGTATAGTATGGACTAG
ATTTCAGATATGATACCCCAAGTTGGTAATCTTCTCAGTAGAAATAACCTATTAATCAAA
CTGCCTTTCATAATTGTGACCACACATATGCATGGGATTCAGGCTGTTTTTTACTTTGAA
TTACTGACATTAACGTTGAAAGCCTCTGGATATTACTAGCTTTTAGTCCCGGAAATACGC
ATAGAACCCACTGTTGTGATAATGCAAATTGGATTGGTTAAGTCAAATACGCAGTTAATG
CAGTGGGTGGTACAAAAATTCATTACCCTAGCTTTCAGAAGCTTTCATATGAATGAGGGA
CAAATTAGAAACTTGTGAGACTACTGTGAAAAAAATTAGAGGCAACAACGGACAAAAATG
ACTTTCTTGGCCAAAGGAATTAACCTGGCAGTACCTGAGGCTTTTGCTGATAGAATAAAG
TTATGAGTGAGACTTTCCTCAGAAGATTTGGTAAGGATGTTCTGCATCCACTGATAGACC
TTGAACAAATTGTTGTTCTTTTGGTTTGCACTAGGATGCGAAAGAAAAGACTCCCTGCGC
TTTCTGTCTGTCTTTGTGGCGGCCCAGATTGAATAGGGGAATACATATGCAGCCTGGGAA
ATGTTTAGTACTTTCGTATTAGAAAAAGCTGTTAATTCAAGTCTTCCTTGTTTTTACAGT
AACAAATTCAGTAATTGCTTTGGATCTATCACCCGTCGTCGTAATGGCTGCTGCTTTTCA
TCCACACAACAGGACTTAGATGGACTGATGCCATCTTGAACTCATCTTTTATTTTGATCC
TGATTTATTTGGAGCGGAGGCATTGTTTTTAAGAAAAACATGTCATGTAGGTTGTCTAAA
AATAAAAATGCATTTAAACTCATTTGAGAGAATGCCTCTTAGTTTAATATATTTAAATTC
ATCCTATAGATTTTCCTGGAGAAGCTAGAGCCTGTTTGTAGATAACTGCTATGCAGCATA
AGACTGTCTTCAGATAACTATGACTACAGTTAACCTACTTCTGGGACTGGAATATAAAAT
CAAGAACCAAAAGTCTTAATTGTGATTTGAAGGGAGAGACCATGTTCATAGCAGTGCCAG
CATTTGAAGTGGATCTATATACATTTCATCATCTACAAACCGAAGTAGCTAACTCTGGAA
GAGTTTACCAAAAGAATAAAAAGAGACTATAATACATTTGGAAGCTAAGTATTGTCTGAG
CTTATTTATAAATCAAGTAGAACCAAGTTCTAGAGAAATCTAGAAGTCTTCTGGAATGAA
TGTGGCAAACTTCCTGGCGTTGGGATAGTAACTAGAACAGGAGTCAGGCAAACTTGCCTG
TCGCACCACCTGTTTTTGTACAGTGCATGAACAAAGATGGTTTTATATTTTTAAATGGTT
GAAAGTCAAAAATACCTTGTGAAAAGTATATGAAATTTAAATTTCAGTGTCCAGTTTTAT
GACATACGCTCTTTTCATTTGTGGTTTGTCTGGCTGCTTTCACACTATGGCAGAATTGAA
TGGTTGTGACAGAGTAGGGCCTTCAAAGCCTAGCATACTTGCCATGTGGCCCTTTATAGC
AAAAGTCTGCCAGCCCCTGATGTCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved