Dasypus_novemcinctus Locus Mono:20:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:20:SNORA70
Dasypus_novemcinctus
Mono:20:SNORA70
scaffold_8527
SNORA70
1001..1133
2133
TTATAAAAATAAAAATAATGTAACGAAAAATTGAGGAATTAGGACCTGTTAGTAAGTAT
AATCTTGCTAATTATAAAGCCGATGCATTGAAGAAGTAGCTTATATATCAAAGATATGAT
GTTTACGTAGTTTAGTTAGTGGTATAGAAATAACCTTAAAGACTAAAAGATAGGTTACGG
ACCTTCGAAGAAACCCCAAAAAGAGGAAACATACAAAGAAAAAAATAGAGACCAAATAAC
AAAAATTTAAAAACAAAGGAAGCATTAAAACAGAAATTATAACCTAATTAAAAGAAAGAC
AACTAGTAAGATTAAACATGGTGTATAAGCTTCCACTGATGGCAGCTAGATAAATCAATA
ACTGAGAAACTGAGATGAAATGTTTTAACAAATCTTCTCAAAATCACTGAGAAGATAATT
GGATAAAGGTTTATTTTCCGGACAAAATCTGGAATGAGAGAATCCAGAGAAGGAAGGAAA
CCACTCAGAGCCATAGTTCTATACAATAATAGAATAGATAACTCAAAGTATGAATTTAAT
AGCAGATGATACATAGTTAATGAAAGAGTTGCCAGGCTGGAAGTTAGATCAAAAGAACTT
ATCAGAATAAGCACAGAGACAACAAGTTGGAAATACTGAAGGAAAGTAAAAGATATCGAA
GTTATAGAGGAAAGTTTCCAGAACAGGAAAAAAATGAAGGAAGATGCAATATTTTAAGAA
ATTTCAGCTAGCAAATTTCCAAAACCGATGAAATACATTCAATTTAAGAATCAAGTTTAC
AGGAAAGAAGAAAGAGAGTGAGGGAGGAAGAGAGGGACAAAGCATTCTTAAATGCATCCA
ATCAAAATAGATGGATTAAAATAGTTTAACTTCAAAGAACAACAATTAGATGGAGAGCTG
ACAACAACATAATCTTACTCAGAAGACTGTGAAATGTTTCCTTCAAAGGGCAAATCTGGA
TTCTACACACCACAGAAATATTATTTAAGAATGAGAGTCCTCTGCAGCCAATAAAGTTGA
CCAGCCCTCTCTCCCCATGGTCTTGGTGTGTAGTGGCTGCAGATAGCAGCCTCCTTGGTA
TTGTACGTGGCCTGTTGCCTGTACAGGTTGCCATAAGGGAACTTGGAGACAGCCTTTCCT
TACCTATTGCTGGTCCTGTCTGTGACCTCAAGCCATCCCCAATCTAGGCTTCAGATAGGT
ATGCAAGGTGCCTTTGGAAAGCCTCAGGGGCAGTGGCCTGGGTCCACATTGACCAAGTCA
TCATGTCCATCCGCAGCAAGCTTCAGAACAAGAAGCATGTGGTTGAGGCACTGCACAGGG
CCAAGTTCAAGTTCCCTGGCCGTCAGAAAATCCACATCTCCAAGAAGCGCGGCTTCACCA
AGCTCAATGCTGATAAATTCCAAGACATGGTGGCAGAGAAGCGCCTCATCCTGGATGGCT
GTGAGGTGAAATACATCCCTAGTAGTGGCCCCTTGGACAAGTGCCAGCACTGCCCTCACC
TGACCTGTGCCATACCAATAAATTACTTTCTGGCCATCAAAAAAAAAAAAAAAAAAATAG
ACTGAGAGTGAAGTAAAGATATTTTCAGAGAGAAACTTATGAGAAGGTTAAAGAAATTAA
GTTTTTTGAAAAAGTAAAATGTATATACCTATTTCAATTTGCCAGGCTGCCAGAATGCAA
TATACCAGAAATGGGTAGGCTTTTACAATGGGATTCATTTTGCTTGCAAGCTTACAGTTC
TGATTAGATTTGAAATGTCCAAATCAAGTCATCACCAGGTGATAGTTTCTCTTCAAAGAC
TGACTACTGGCAATCTTGAACTCCAGTTCAAGGCACATGGCAGTGACTGCTGGACTCTCC
CTTTTCTTCAAGATTTTGTTGCTTCAGCTTCTGAATGTCTCTGGCTTTCTCTCATTCACC
TGCATTCATCCTGTTTATAAAGGACTCCAGTAAGGATTAAGACGCACCCTGGGACCTGCC
TTACTGAAGTAATCTAACCAAAAGGCCCTTAACTGAAGTAACCTAATCAAAAGGTCCCAC
CTACAATAGATCCATACCCACAGGAATGGATAAACTTTAAGACATAATCTTCTGGGGTCC
ATCCAGCTTCAAACCATCACAATACCCATAGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved