Dasypus_novemcinctus Locus Mono:125:SNORA8
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:125:SNORA8
Dasypus_novemcinctus
Mono:125:SNORA8
scaffold_45738
SNORA8
1001..1139
2139
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTCTTTTATCATTTCCTATTCCATGGACATTGGATAGATT
CCCTTTTTTGGCTATTATAAATAAAGGTGCTATGACACTTCTTACACAAGTTGTATATGC
ACATGTGCATGCCCACATACATTTGTTTCATTTCTCTTTGAGTAAACCCCTAAGAGCACA
ATTTCTGGGACATACAATAGTTGTATATTTAATTTTATTAAAAAATGACAATTTTCAAAG
TGATTTTACTGTTTTGTATTCCCATAAGCAATATATGAGAGTTCCAGTTCAAGCTTACCT
TCACCAACTCTTGGTGTTTTCATTTGCTAGACTGCTGAAAACACATCCTTTAAAATGGGT
TGGCTTATAACAATATTTTATTATTTTACAGTTTGAGGCTGTGACAATATCCAAATCAAG
ACATCATCATTGGGAAGCGAACTTGGCCCAGTGGTTAGGGCATCCATCTACCACATGGGA
GGTCCGCGGTTCAAACCCCGGGCCTCCTTGACCTGTGGAGCTGGCCCATGCACAGTGCTG
ATGGGCACAAGGAGTGCCGTGCCACGCAGGGGTGTCCCCCACGTAGAGGAGCCCCACGTG
CAAGGAGTGTGCCCCATAAGGAGAGCCGCCCAGCACGACAGAAAGTGCAGCCTGCCTAAG
AATGGTGCCACCCACACGGAGAGTTGACACAACAAGATGACACAACAAAAAGAAACACAG
ATTCCCTTGCCACTGACAATAACAGAAGCAGACAAAGAAGAAGACACAGCAAATAGACAC
AGAGAACAGACAACTGGGGCAGGGGGGCGGGGGTGGTGGGAAAGGGATAGAAATAAATAA
ATAAAATAAATCTTTAAAAAAAAAAAGACATCATCATCAATAGTACTGCATGGTATCTGC
ACTCAGCATTTTTATCCTACTGGGGAGTTCAAAAGACAGTGCTACAGAAATTCAGTATCT
GGCATCGTTGGTTTTCTTGGTTTTGTGCATGTTAAACCTGGTATTTCTATTGATACAGTA
TTTCCATAGTTTTTCTAGTACTCTTCAGATTGGTATAATCATCAATAAGAATAAATTCTT
CAGGAAAAAAAAAAAGACATTATCATCAAGATGATGCTTTCTTCCTGAAGACCAGCTGCC
AGCAATCCTTGGATCCTCCGCCACATGGCAAGACACATGGCAGCCTCTGCTTGTCTCTCC
CCTCTTTTCAGCTTCTTGCTTCCATGGCTCTCTCTCTTCTGGGGTACTTACAGTTCTAAA
CCATTACGTAGTAGTGTGTGATGTTGTACCTCTTTTTAACTATAATTTGAATTAACTTAA
TAACTAATGCTGAGTATCTGTGCATGGGCATGTTGGCTATTTTCATGTCTTCTTTTAGAA
AGTGTGTTGGTTCAATGCTCCCACTCCCTCTTTTATGGGATTCTCTGCCCAATATTTTAA
CTATTGAGTTGTAGAAGTTCTATATATAATCCACATACAAAGTGCTTTGTCATATCTACA
TACTGTAAATATTTTCTTCTAGTCTGAACCTTGCCCATTCATTTTCTTAAGACTATTGAT
GAGCAGAAATTTATAATTTATAATTTTATAATTTTGATAATGTCCTATTTGTCAGTATTT
TCTTTCTGCTTAGTATTTTTGATCCTAGGAAATCTTTTGACTGCCACATAGTCATAAATA
TATTCATGTACATTTATTTCTAGAAGCTTTAGAGTTTTAGCTTTTAATTTAGGGTTAGGA
TACATCTCAAATTAATTTTTTTTGTATTGTATTTTTTTAAGATACATAGATCACCAAAAA
AGTTACATTAAAAAATACAAGAGGTTCCAACATACCCCACAACCCACCATACCCCCCACT
CCTCCCACATCAAAAACCTCTTTCATCATTGTGGCACATTCATTGCATTTGGTGAATACA
TTTTGGAGCACTGCTGCACCACATGGATTATAGTTTACAACTCCCCCAGTATCTTCTGTG
GGTTATGGCAGGATATATTTGAGTGGTATGAGATAGGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved