Dasypus_novemcinctus Locus Mono:289:SNORA9
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:289:SNORA9
Dasypus_novemcinctus
Mono:289:SNORA9
scaffold_179180
SNORA9
1001..1135
2135
CTAGACAGATGAAGTATTACCCAAATCATAATTCTTAGTTCCATTCCACTTAAACAGAT
TTTTTTTTCACATTACCATTTTACCTTTCCTCATGTAGTTTGTATACATAGCAAGATGAA
CCTGGGACATGACTGAGCTCGTTGCTTGGAAATCCTCTAGGCTAAGTATCGAAGTTTATT
GATTTTGAGTTCTGCTCTTTACACAAAAAACTCTCAGCAATGTTTTGCACTTGGGGAGCT
GAGCGCCTCTTCTTTGCCAGCCCCATTGGGTTAGTTTTGTAGCGATGCTGCAACAAAGGG
CACAAACTTCGTGACCAAAAACAACAGAAACTGCCTGGGTCAGCTCGGGATTCCACCACC
TGTCCACCAGCCACCTGGAAAATCCCCACCATCAGCACAGTCTGTGAAGTCCAGGGAACC
CCTGAGGGATGCTGGACCTGTCTGCCCGCCTTCCCTTCCCTCCAGCTCCTGGAACAACCT
CTGCTTACAGCATCCTAAGGAAAACCTTTATTGAACTAAAAAGCAAACAGAAATGTATTC
TCTCATGGTCCTGGGGAGCAGAAGCTGGAAATCAGGTGTTGCAGGGTGGGCTCCTCTGGA
GGCTCAGAGGGAGAAACCGCCCCTCCTCTCCCACAGCTCCCGGGGCTTCCAGCCAGCCTT
GGTGTTCCTTGGCTTGCAGGTGTGTCCCTGCGGTCCCTGCCCTCCCATGCTGGGGTTTCC
AATCACCCCTCCTTACTAGAACACCAGCCACTGGATTAGGGCCACCCCAGTCCACAGGAC
CTTATGTGAACTAAGTGCATCTGCAAAGACCCTATTTCTAAACAAGGCCATGTTCACAGT
ATGGGGAGGTTCACACTTCAGTATACCCTTTCAGGAGACACAATTCATCCCATGACACCT
GGTTTTACTTGTTGGTTCCTGGAGGTTCTGGTTTCAGAATGTTGCTTTCTGAAGAGAAGC
TGACATCAGGTTCATAGATGAATTACAGAAGGACAAGGGGCTTGCAAGCCTCCAGAGTGC
TTGGGTCTGCAGTGACCCTGTGCATTCCTACAGTGCTTGCAAGAACAGTTTTGAAATGGT
TTGAGGCCTTGCTCTGCTCCGTCTACGGGGCAAGGTTATAGAAATTTCAGACAGTTGCTT
GCCCCCTCCCAAATCTCATGTACCAGGCATCTTGTCTGCACTGTCTAATATTGTAGCCGC
TTTGCCATGTGTGATTTATTTATTTATTTATTTTTCTTTATTAATCCTCCCCTCCCCCAG
ACAGTTCTCTCGTCCGTCTGCTTACCTTCTCCAGGAGGAACTGGGAACCAAACCTAAGAC
CTCCCACATGAGGGACGAGTGCCCAACAGCCTGAGCCACATCCGCTTCTTGATTTGTTTA
AAGCAAGGTAAACTTTAAGATTCAGATTTTCAGAGACTCTGAGTCTACAGTGTATGCAGT
TAGAGAAACGAAGGCTAAGTTTTTACTGAAGAGCTGAATGCCTAAGGAACTGGGAGGGTG
AGGGCAGCATGAGCTGATTTTAATAGAAGACTTGGAGAGTCGGGCACAAATGTCTGCTGA
GCACATCTTGTGCCAAACCTGCTGATGCCCAGCTTAGTTTCATTGTTGAGGCAAATAGTT
GTAGCTCCAGCACAGGTGAGGAGCCGCAAGGTCAGAACTGTGTCCAGGGTTGCCCAGCTG
GAAACTAGATTGGGGGTTTGACCCAGGTCTTCATAGTCTAAAGTATGTGCTTAACTTTTC
CTTGTGCCAGATTGGGAGGCTGAGTGGAATCTAGACTGGGGTAGAAAGTGGGTTTGAGGG
AAATGCCATATGTCAGCCAGCGGGCTGGGAAGGGTGTGGTGGGCTTGGACAGGGCAGCTG
CAGCTCTGCTGTGTTCCTCTGGGTGGGGGTGTGGTCAGCACTAGACATGGTGCTTGGAAG
GTGGAGGCTTCCAGCTCTCTCTCCAGTATGGGAGCAGATGCTGAACATGTTGGACTTGAG
CAGGGTTCCTATTGGAGACAAGTCTCAGTCAGCCTCATGTTTCTGTGTCTTAGGAGTGAG
GTATTACAATATGAGAGTAAGTCTCTCCCTGCAGAGCAGAGGGCAGGCATGCTTCCTGTC
CACCATAAAAGATGTCGGTGTCCTTTCTGTAACAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved