Dasypus_novemcinctus Locus Mono:405:SNORA9
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:405:SNORA9
Dasypus_novemcinctus
Mono:405:SNORA9
GeneScaffold_1435
SNORA9
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGACATGGGC
AGTCTTGCTGCCCACCTCCAGAAGCAACCACTTCTAACTATTCTAAATATGACTCCAGGC
AAATATCTCCACATTGCTAAATAATATGCACTTACTGTTTTTTCTTAATTTATCTATTTT
GGTCCTCATATCCCGATTTCCTGGTGTAATAAATGAGCTTTATTCCACTTCCCTTCCTTA
CCCAGCCCCAGACAAGGTCTTCTTCTGGTTGTTCTAGAATCTATGCCAAGAACTCTCTGT
CTTCCTGCACCAACTAGAAGCAGCTATGGGTTTCTCACAGTTTAGTGTGAGTTCAGCTCA
TTGTGGCAGAGAAGGGAAGAGACAGCTTTTGTGCCACAAGACTGCAAGCCTCCAGCGTGC
CAGGGTCTGGGGTGACCCTGTACATTCCCACAGAGCTTGCAAAAACAGTGTTGAAATGGT
TTGAGGCTTTGCTCTGCTTCATCTACGGAGCAAGGTTATAGAAATTTCAGACAGTTGGGG
GTAAAAAACAGAAGAAAGCTTCACGCCTATCATCCTCAAAAAGGCATAGCTTTTACTGAA
ACAAGACAGATAGAATCTGTGAAAGGTTTACTGCACACCAGACACCCCATGAGGCAACTG
ACACAGACTCTCATTTGACAATGACAGGAGCTGCCAGCCCAAGAGAAGCGACCGTCCCCC
TCTGACGGGGCTCTCTGGGGAGAGGGAAACTGAGCAGAGCCAGGCTGTCCTGGGCTGCAC
CTGGCTTGTTCCAAGGCTATCTTCAGTCCCAGCTCGAATCTTCCATTTCCTTCAAACAAG
AAACAAAAACCTAAGCCCAATGTAGTGGCCGAGAGCCTTCGCTCTGCAGCACATGACCCA
GGCTGGCATCCTGGCTCCCCTATTAGAGGCTGGGACCCTGCTCTAGACAATCAGTTCAGT
GGGGCAAGCACTTAGCTCGCCTTGTGCTAATCAAAGATCTTCCCAGTCTGTCTTGTATTT
ATTTACTCAGGGTGGGAGAGCGTGGTAACAAGTGGATTAGAGATTACCCAATCAGGCATC
CAGCAAAGAGTTCGTGCCAGCGTCTTATTAATGCCTGTATATAGTAGGTAGTAGGCAGTA
GGTGCTCATTAAACAGTTATTTAAATTTTGAGGGGAATGAGACAGTTTCCACCAGAATGT
CAGAATAAAAGGACTGACTTACAGATGTCCACAGCCATCTGCCCCCTCCTTGCCACCGCA
CCTTCCCTGTTCTCCAGACCCAAGAACCCCTCACCGTTCACGACCAAGCTCTCCCCCACA
TCCCTACCCTTCCCCCACAGGTCTACCTCCCCTGCCTGGAATGCCTTTCCCACTTGCAGA
CTATCTCCTTTGCTCCCTTCAAAGTGCAGCTCATATTTTGCCTTCTCCAACAAGCCTCCT
CCCACTGGTAGTTTCCTTGTTTATCAAACAGGGGACTTTGGCCAATGTCTAGAGGCATTT
TTGGTTGTCACAAATGGGGAGGCAGTGCTACTGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved