Dasypus_novemcinctus Locus Mono:23:SNORA15
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:23:SNORA15
Dasypus_novemcinctus
Mono:23:SNORA15
scaffold_9588
SNORA15
1001..1138
2138
GCTTCTGATTTGGAATTCTTCCTAGCTAATCTATTTTCTGGGTCTTTCTTCAAAGCTTA
AAAATGTTAAAGTGTCCTTGTTATATTTGTCATAAAGAGCCTGTAGCAAACCCTAAATCA
AATGAAAGCAGCCTTGAATATTTCACAAGACTACAGCTAATGTCTTTATCTCTCTAGCTT
TCGAACCTCTGTTTGGAGTTCAGTGGAAATTTAACCTTTTTGGACTTCTTCCCTTGGTGA
CTCACAGTCTCTGGAATCAATAAGGTCTGCATTACTTTACAGCTCAACTTAATTTAATAT
ATGACAAATGTAGGAGTCAAAAATAGCTAATCAGAGTCACTAAAATGTTAAAACAAGTGA
ATTGTGACTCAGATTTGAAGGACATGTGGAACTTTTCCTCCTGTTGGGTTAATGTGTGCT
TCTGGATTAGGGTTCTAATATTCATGATTGTTTTTAAATAGTGAAGTATCTCAGAGGACT
AATTGCTTCAATTGGAGCGAGGCAGCCTGCTTTATGAACTTGCTGAAGTACAGAGGATCA
GTCCTAGTTCAGCCCTCTATCACTAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAAGCTAGTACATTAA
CGTTTTGTAACTCCAACCTTTTACTTGTTTGCTTCAAATAGGATCAGAAGCTATTCCTTT
TCAATTTTGCAATGCCATTGATTTCATTATTCAGAAATCTCTTCTGCTAGAGGGGGTGGC
AATAATTCCATGTGTGAATCACTCCCATAATATCTCTCTGTCCACTAGCTCTGTTTTGTT
TTGTTTTCATTTGCACAATTTTACATGATCCCTTGATTTATAATTCCTCCTAAGTAATTT
ACATTTATTCTTATGATTCTATTCATTAAAAATAAATTTAGTCATGGCTGAATACTGTGT
TCTTTTATCAGTAGTTTACACAGCCAAACACCATGCAAAAATATAGTCTTCTCTTCAAAA
CTGTTATGCTGGTATGCTGTTTTCTTCACAGCATATTATTATTAAAGGCGAATACAAATG
GATAAATTTGATATTCTTTTTGGGTAAGCTCCTAACACATACCTACATGTAAGATTTCAT
AGTTGACACTGAAAGAACTTTTGTAGTATAAAAATAGGATAAAAAAGTACTAAGATAAAA
GTAATGAGTAAGTAAAATCAGAATGTTAGATCTGTTTTTCAAAGTTTCATACCATTTCAG
TATGTAGCTTGTATAAATAAGCAGTAAACTCAGTTGAAAACACTAAATAGGTCCTTTATC
CCCGTGAGACAGAAATTATACCATTGACCTCATGATAGCTCCATGGTAGCTGCCCTGAGG
ACTGAACCAGTGTTCTTTCTGCATAGTTTAGTAGTTTAGTATTGGTACTGGTAATGAAAG
GTATTCATCCATGATTTATTGCTCTCATAATGACAGGTAATGATTAACTGCATGAGGCAG
TCAGATTCTCTGCTGGCCGAGCAATTATTCTTTATAGCATAAAAGAAGTTTCTCGTAAGC
AGAGTGGTGTCGCCTCAGATGCTCTTTGATTACATGAGAAACACTATAAAATGATATTTT
ATGTAGCAAGAACCATTTCCAGCATAATGAAATATTTTCAATTTAACTTCAAAATGATGT
ATATAAAAGTGTAACATTTGCTAGTCATCCTATCCACCTCAGTCCTGGGAAGACTAGCTC
AGAGTTAAATGGGTGGTAGCTTCCATTGGGAGTAGAATGTTTATACTGCTTGCTGTCAGA
CCACTGGCTGAATGGCCCTGGACACAACTGCTTTTTCCAGAGTTGATTCCTGTTTCCCTT
TATATCCTGTTCTTCCTCCATGCCTGTTTTTCATGAACACCACTTTAATTGCAGACCACT
CCACCTGCAATTCTCTGGCAAATGCCTTGGCCCCATCTCCTTCTAGGCCTACCCCTGCTA
CAAAGTCACCTTGGAGATAGCTTCTCTTTATTTGTTGGAATATCCTATTTGGTTACCAGT
GGTGGTGACTGTGGTGGTGCTTATTAATTAGAGTTTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved