Dasypus_novemcinctus Locus Mono:425:SNORA44
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:425:SNORA44
Dasypus_novemcinctus
Mono:425:SNORA44
GeneScaffold_834
SNORA44
1001..1113
2113
AGGGAGCACTTCCTGGCTACTGTGGGGGTTTGGTATCTCATGTATGTTGTTTCAGGTTC
TTTGTCTCTCTGTTTCTCACCCTTCGGGGAGTTGTGAAGCACTGTCCTGGTCTGCTGACC
CCCAAAGCAAATTCCCCATATAGCTTTTGGCACTTTCTCCATTGTTTTTGTGAGAAAGTT
GAGCCTGCTTGCCTAATTCAATATCATCATCCTGCAGGTCATCTGCATCACATTTTTATA
AGAAGAGAAAACAATAAAGGTATTTATATTTAGAGAGGAAAGGTTTATTAATGATATTTC
ATTTAGTGGATAAATGGAAACTGTATAAATGCCACCATTAAAAAAAATAGAAATTGGGGT
ATTCTACTAAAATTCTACTAAAATCCCTAGCCCCATTTGCCCTATTTTGGCACTTAATTT
TCATGTTTTATCATGAACATTTTTAAGCCTTTTCTTTATCACATTCCTACGCATTTATTC
ATTCATGTTTAAATCAAACACATTTCAAAGAAAGTACCTGTCTCAGTTTACTATGGTGGC
TGTAACTATGTACCATAAACTGGGTGGCTTTAAACAACAGAAGTTTATTGTGTCGGTGTT
ACAGAGGCTAGCAATTTGAATCAAAGTGACAGCAGGGTCATGCATTTTCTGAAGTCTGTA
GGGTTTTGGTGGTGGCTTGCAGGCAACCCATGCTGCTCTGAGGCCTAATTCAATCTTTGC
CTCCATCACATTGATGTCACCTCTCTGTCCCCCACTGTGTTAAAATTTCTTCTGTTTATA
TGGACACCACTCATATTGAATTAGGACCTACCCCAATCCAGTTTGGCCTCATCTTTAAAC
AATGACATCTCCAAATGTCCTTTTCTCAATCAGGTCATATTCACAGGACCTGGGATTAAG
GCTTTGAACATACCTTTTTGGGGGACACAATTCAATCCACAGTAGTAGCAGACATCAGTA
TGCTATTTGATACTCAATTCTAACTACTCTCCAATTTCCTCACACCCATGTTCAAAACTA
GCTCAGTCCAACTGCATGTGAGAGCAACCTGGAAAGACTTTGACAGCCCAGGTCAGCAGA
GTACCTGCAGCTGCCGCTCGACTTTCCTATAATGTCTCAGGACCTGGGCTTGGAGGGACT
CGAGGCCAGGTGTTTTCATTTATTCTGCAGGTTCCCCCTGAGTTTCCAAACAGTGTTAAC
ATGTCTGAAGATTCCAGCTTGTTGCTGGAGCAGGTCTGTGATACCTAGAAAGCCACCCTC
ATCTGATTACGCACCTAGAGTTGGGAGAAGCCCTCAGAAGAGGCAGGCTAAAAGGCACCT
GGCTGGTTATTAGGTAGAAATTGTGAACTCTGCAAGGAGAGTCCTTTGCTTCTTGTTGAG
TGCTTCTATCCCTTGTGTCTGACATGTTGATGACCAATAAAATATTTACTCTATGGAAAA
AAAATTTAAAAAAATAAAAAATTAAAAAATTAAAAAAGACTAGCTCAGAACTTCTCACCT
GTCTGCCATACATTTTAACCTATCTCATTTCCTATAACTTGGCACTGTTTACAGTCTACA
TGTGTCCCAAATCAGCTGCTTATCTGGAGGACAACATTTACCACATCTTATCCTTGCTCT
TTCTATATATCCAGAACTGTGTAATTGATTCAATTTATGGATATTTAGGCCAGACTGGAG
CATTATCTGGTCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved