Dasypus_novemcinctus Locus Poly:6:SNORD116
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:6:SNORD116
Dasypus_novemcinctus
Poly:6:SNORD116
scaffold_34687
SNORD116, SNORD116
1001..1091, 3331..3424
4424
TTCTCATGCCCCATTTTGCATACATGTTTTCTGTTTGAAATAGGGTTCTGCATTGCTTA
GTTAAGGGCATTTTTTCTCATTGTTGTGAACAAACCCTTGTCTCAAATTAGGTTTGAGGT
CTGTTAGATGGACTTCCTGTTTTGTCATTCAAGGTTCTCATATTTCTCATTCCATGCCTG
AAGTTTAATTTTCTGATGGTTGTTACTTTCTGACCTACTTACTTCATTTCTATGTGGTCG
AAGTCATTGCTACAATCTTGAATTCTAATTTACTTTTAGGAAGAATGTCCGTTAACTATG
GGTGTGCCCTATGTACAGTAGTGGGGAAAAGGTAAGGGCTATTTGACATTTTTCTCCATC
TAAAGTTGGTCGAATTGAGAACATAACACCAGCTTCGTGATCTGAAAATTATATGCCTGA
TATGTTTTCTGCCAGTGGAAGAACCTTAAGTATAACATGCTTATCTGCACAAGCGCAACA
TGTCTAAGGGTATATCTAAGTATACACATAAGTGCATAGCTGCTGGAAGGAAATGAATTA
TCGATGCTTGGAACAAAACTCAAATTTATGAGTTTACCCTGGTCCTAAAACTTCTGAGTA
TTGTAATCATGTTTGTAATTGTTCTTTATACACCTTTTAGGTTGAATTGGCAGGGAATTA
ATGCCATGTGAAGGGAAATCAATTCACCATGTGTTCTCTACCAAGAGATGTAAGGGAATC
CCTGGAAGATCTGTGGCCAAGCGTCTTGAGATTATTGGACATTGCACATGGTGGTAGGCA
TTTATATTCCTAACCTACTGCTATTCTACCAAGATTAGGTCTGCCTCCAGGGACCTTGTG
CCTGCCATTCGCAAATGGTGTACTGAGATTCAGTCCTTGAGTGTCATTGGTCTTCTACAT
GATCAACAACTTGGCACTGAAAATCCAGTGTGAAGAAATGTTTAAAGATATGTGTTGTCC
TAATGCCATGCCTGGCGTTTTAAAGTTGGGCATTCTGTGATGGATTGTTGATGACACCCT
CAAAGCATTCCTTGGAAGTAGAACAAAATGAGTGAGAACTCTATACCGTCTCAGCTCATT
GAGCTGAGGTCCAGCATGTTGCCTCTTTCCTACACATATGTGATTGAGGGCCGTTTCCAT
GTGTTCCCTTTCACACTGCCACTCAGTGCAGGAATCTTTCACACGTCTCCCGTTCTTGGA
TTATAGAAAGATGTGGTTTTCCCTCGGCTTGAATATAGGGTCCCTTGTGATGGGGGCTCT
CTGAGGGCAAGGCCCCCCACATGCACACAGGATCTGTGCATTGGTGGGTGTGGACTGGTG
GTGTCTTGTGACTTCATTGTATGGAAGGTGCGGGCTGTGGAAGTCTAGGACAAAGAAAGC
AGGTCCAAGGTGTTAGGATTAGTATATTACTAAGGCCATGGAATTAGGAATATTTTCTAG
GTTCTGTTTTACATTTTATGAGAAAAAGTGAGTATCCACCCAGATGGGGCATATTGAATG
GAAGTAGTGTTAAGGATGGTGAAAATTCTTTAAACCCCTCTTGAATATATTGAGGGGTAT
CATAACATTTTGCTTCAGTTTTGACAGCCCAAGGAATTCACCGCTCTGTGCAGCTTTCAG
GTAGATAAGGAAAACCCGGGAAAGAGTGATCATGAAAATGTATGTCATCATTAATGGTTC
AACAACTAGAGATTCTGTAGATTTTTGTAGGATTTCTATGCTTTTTATGGGTTACATCAG
CATGACTAATTTTGCATGGAGGGGAATGGTATAGCCTCTCTGTTTGTGTAAGCATTTCAG
AGAATTGTCTTCCTTTACTCCCCAGCATATATTCTAGAGAAGTAATCACAACATTCCTGT
ATTGGAATGGTGGGCCTCTTCTCCCAGTTCACAGTAGTTTCCTAAGGGAAAGTGTTTTTT
TTAGTAACAGCCCACTTGATGCACATCTCTTCATTAAAGTGCACTTTAAGAAAATGTTTC
TTCTCCCATGCTGCTGTGTCCTGCACCAGTAGGATTAGTGGAAACTAATCACAGTGCCAT
GAATCCAGAATTTAACCTCATCCAAGGGTACTTTTGGCATTGTTGCCCTGCTTTTGTTTT
GTTTGTATTGTACAATTGTTTATGTTTACTATATTTTACCATGGTATAGGTGTAAGTAAT
AAGTTCTAAAGATAGGAATGAGAAGTTAGACCTTGTATTTTCAGTAAGCAACTCCTCATG
ACATTAGTTTTGAAGATTTCAACTCAGGACAACCCAAGTTAGTATTAGAATTTGTTTTAT
ATATGTGGGTTTTTCCATGCAAGAATGTGGAAGAGAGTGTTTAAAGTTGGTTACATGAGT
GTACTTTTGCTGGGCTGTCAGGAATGTGAAGCTAACTGAGTGTGAAAATAATAGGTACCT
GGGAATTGCCCTTTTTCGGTAAGATCTTTATCATGGACCCCTCATACAAATTTCCCCTGT
TGTATTGTTTTGGCTCTTGACCCTGTGAAGGAGGAATTCGCTAGAATGTTGGAAAAAAAT
GCATGTTGGAACCAGGTGTCGAATCTGCAAATGGACCCCTCTGCTTCTTGGCCAGATATT
CTGGCTGTGCTTCCATTGACCCCTGATGTGTTATTTCCTTGTGATGGTTACCTTCTGGGA
AAGTCTCTTGGGCCCAAACATGTCATTGGAACATTTGAAGTCAATTTCAGGATGATTCAC
AATGTAGATTATGAAATGGTGTACTTCTTGCCATGCACGGTTGATAGGAGGAAGGCAGTG
TGGTAGATATCATCATTAAAACCTGGGTACAACGAACAAATTAATGGTAGATGGTACTCT
GTTTATTAGAAGGTATCCAAATATGAAGTCAGAGGAATAGTGCAGTCAAAAGAAGGCTTT
TGTTGTGGGAGGCAGAATTTTAAATGCACATATTCCAAAATGGTTCCACACAGCAAATAT
GCATACATCCATGTCATCACACAAACAAATGTATATAACACAGCCATTAATAATTTGTAG
GTATAACATGTAAGGCAATGGAAAAAGTTTGAACTGGTTGCCTTTCATCATTGGCCATTT
TCTCAATTACATGTGTGTTTTCTGCAGACTTTTCAGGTGGAGATGCCATCGAATGGAAGC
CATTTGGGTGGAAAGACCTGGAGGTGCCCTAAACGCCCTGGAAGCAGTGTGGCCCCGAGC
CTTCCAGTATCTGGTAGGTGGCTCATGGGAGTAAGATTTTTTTTTTTTTGCTTAATGTAC
CACTAGTCTCCTATGGAATACATATTTACTCTCATGACCCCTGCACACCTCAGCCTGCCA
CTTAAAACTTCTGGACTGTAACAACATGCTTGGATCGATGATGACACCCTAATCAGCATT
CCTTGGAAAAGCTGAACAAAATGAGTGAGAAATCCCTACCGTCTCCTCTCATCGAACTGA
GGTCCAGCACGTTGTCTCTTTCTAAGTTACTCTATGAACAAAGGACACACACGTTTCATG
GGTGGTCTGCCCTCCTAGCCCAGGCCTTTTCACTGTGGTGTCTATTGTCTTCAGGGCACT
AGAGAGATTCCGTTTTACACATAGCACTAGGGAAATTCTCCCTTGCCCCTTGGATCTACG
ATGAAGACTATCTTCCCAGTTAGTGGTCACACTCAGTGAGTTGGTTGCTGGGTTTTATAA
GGGAATTTTAATACTGTAACATGAGTCTGTACAGGCATTTGAGATCTTCATGTAGCGCTC
AGCTAGGGGATGAAGACCAGATCTTTTGAGTCATTGACTAGTACCTAAGGTCAAGGATTT
AGCAGTGACATACAAGTTTATGTCATTTGGTGAGAAATTGGAGCGCCAGTGGTGTTTGGG
TGAATGAATGTGAATCTTTGATAGGGATGCTTACAAACCATCTGCAAGCACTGTGAGAAT
CCACTGGAAAGCTGTCATTGCTTGTTTTTCTACTTTTGGCATCAAAATCATATGGAGGTG
CTATGGGCATTGCTCAGGCTGGATGAAGTAGGAATTAGGGACTATTGCTCCTGGAATAAT
TAGATATCTTTAGAAGTTGTTTAGTGGTTGGATTTTCCCCATGTTGCCATGGGTGTTCTA
TGCAGTTTTTTGGTTAAAGGAGGTGTATAGAGGCAGTGCTATATGGAATGTCCAGTGTCC
ACACATACAGGGATTTGGTTTGATGGCTTTGGTTTGCATATGGTGTGTGTTCCACAGTAG
TAAGCATCCTCCTTCTCTTCATAGATCATGGAAGCGATCTCCTCGCCTACATCACCATGT
ATTAAGACCTTAGGCTGAAGGTCTTTCCTGTATCTTGCCAATCCCTGTTCATAGTAAGGT
TCACATGCAAGAAGATGTGTTCTTTTTCCTGAAAAGACTCATATCATCACTTACATTCCT
CTCTCTTTCATGAAGTCTGCTGAACGTCTGATTTATCCATGTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved