Dasypus_novemcinctus Locus Poly:21:SNORD22
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:21:SNORD22
Dasypus_novemcinctus
Poly:21:SNORD22
GeneScaffold_5745
SNORD25, SNORD26, SNORD27, SNORD28, SNORD22, SNORD29, SNORD30, SNORD31, SNORD22
1001..1069, 1295..1367, 1707..1778, 2075..2150, 2512..2637, 2831..2897, 3051..3119, 3381..3448, 3649..3774
4774
TAGCTACACCTCGGGATTTGGGAGGATTAAATAACTGAATTAATACAGCATGCTTAAAA
CAGGGTTCCATAAATGCTAGTTAACTTTAGCCCCACTACAGGCCAAGTCCCTAGCAAAAG
CTGACCAGACAGCAGGAAGTAGACGGCCAGTCAGGAAATATCAGGACCTGTCATGAGCCT
TAAAAGTGGAGCGCCGACGTCCTGACTCACTTTCCCCAACGGCCCCACCAAAGAGGCCTG
CACCTGAGGCCAGGCCGGGACCCAGTACCTGAGTCGCCCCCGGCGCTAGGGCCCTGGTTA
CCAGGCCCGGAATGAACGCCGGGCAGATGGTGGGGAGGCCAGACGACGGCGGTCGAGGGC
TCTGTAGGTTCGAAGTCCATTGGAGGCGGCCCTGTACAACGATCTAGTGTGAGTGGGGAG
AAAGGTGTTCTCAGGACAGGGTGTGGGGCAGGTGGCTGTGACCGAGAAAGGGAGTCAGTT
CAGCATCTGCGCGAAGCCTAGACCACAACGCTTCTGTCACGCACGGAGCCGGTGGGAGAC
CCTCCCTCCGCGCCGGCCGTGTGCACGCCTGCGCAATCCCCCAGGGCGCACGCGCGCCTT
TTTCGCGCTCCAGGTTTAGAGTGCACTCAGTCAACGCCCGCCTTCCCGGGCATTCTCTAC
CCACAACTCCCCGGGCTTGCACGCCTTCTCCTTCTGCGCGTGCGCCCCCATAGTCCCGCC
CCCAAATCCCGTGGCCCTCTGCGGGACATTATTTAAGTCCCTCGCTGCGCTTTTTCGGTC
TTGTTTCATTCGCTGTTGTCTGTGAGTTGTTATCTTCTTTTCGTGTTCTATTTGTTTGTC
TTTATCATTAATGTTCGCCCCGCAGGCCTGGCTTTGGGGTGTATTTATTTGGTCGACTGG
GTGCTGTGGAAGGGGTGGTTTCGGCCGTGGCTTTGAGGCCCCGAAGCGGCGGCGGGGATT
TTTGTAAAGGACAAAATGGCGATGGCGGGTTGCTGGCGGTCCTCCCTATGATGAGGACCT
TTTCACAGACCTGTACTGAGCCCCGTGAGGATAAGTAACTCTGAGGAGACTGCCCCTGAA
AAGCCAATGTCCTACTCTGCTGCCGCTCCGGAAGGAAAAAAATTTGTGAAATACCCAGTG
CTAACTTTTCCTAACGTCTTGTGTTGTTCTGTTTCTTTTTGTCTGCAGGGTTCAGGCACA
CGTTTGAGTAGAAAAGAACCCTGCGCTGATTGGAGTAAGTGCTTTTGGCCAGTGTTTGTT
CCATTGTTAAATGTATGAAATACCAATGGGATGTGCTACAGGGATGATCTTAGGAACTCT
CTCTTTCCGATGGACTAGTGGGGAAAACATTTAAAAATTCTGAGTAGCACTGTCCACAGT
AAACCTCTAGTTTCAGGGGCGTTTTATACTCAGCTCTAAGGCATTAGGGCCATCAGCATG
CTCAGTGAAGAGTGCTTTCTTTTTTTTTCCAGATGTTCCGCTCAAAAGAGCTTACTGGTA
TGAGGATGGGGACAAGACACCTTCCGCAAATGGCGGGTGGCACGAGGCCCTGGAAGAGCT
GGTCATATTACGCCTAGATAGCACCCTTTGATGTTACTCAACATTCAGCTATACAGTGAT
GCTCCAGGTGGGTATCCATAGTTTATGCCATTATCGGAAGGGCATATTGTTTAGATGAAA
CTTGGTCTTTCAGATTGTACTGACCACTGTCCATGATGAATGTAAAAATGACAAGCATAT
GACTGAAGTTAAATATGATGTCATCTTACTCCTGAGAAGTGAGCCAGGGTACTGATGAGC
TTTTGAATGGCTATCCTCACCTGTATGTAACATGGCCCTTTTTTGTCTCCAACTTATCAC
CAGTCCTGAGGAATTCAGCTTCCCTGGGGCAGTTTCAGGTAATTGTTCAAATGGGGATTT
TGGGGTGTGAAATGGCTCATGTGTGTCCCAGAACCAGAGAGCAAGTGGTCAGCTGAGCGT
GGTTGCCCTTTTTGCTCCTTAGTTCTGGGAGGGGAAAGCAACCCAGCACTATAGTTGGTC
CTTGTGAGGGTACGCAATGGTTGCATTCTGGCACTGTCAAATGATTTGAAATAATAATGC
TGATGCTCTGTGAGGTATGACAGTTAATAGCATGTTAGAGTTCTGATGACAGTTGCTGTT
GTGAAGGAATTGTGTTCTGTCCTTATTTTTTCAAAGTAAAATTTTGCTCCTTTTTTCCAG
GTCCTGATGCTGTATCATCTGTCTTCTGTAAGTTACCTATGGTAACTATGGTAAATGAGG
AACATTATGGTTGTGAACCCATTATCCAGGATGAACTAATTTTACCTTCAAGGTAGTTTC
TTAGTAACCAGAGCCCTGGTTGTCAAATTTTCTGGTTCCTCTTCCCTGGGGTGATGTTTT
CTTGACCTTTTATTTCTCTTAGGTACCCAACAATATGCCAAGGTCCGGTTGCTGGAAGGA
GCTGAAAGTGGTAAGTAGTTGTAATTTTACCAGGTACAATTTGCCAGTTGAGTGCCAGTG
AGGAGCAAACATCTTGTCTTAATCCCTGTTATGGCCCCAGAGCCAGTAATGGTGAACCCA
CTGGGGCTAACTGGGAGAGATGATGATAACTTATTCCATAAGGAACTGTCTGAGGTACAT
AGGTGGCTACTGCATTTGTTTAGTTTTTCATATCCATAACCATGGCTAGAATGGCTTTGG
ATATTTAGAATATTTAACTAATTAAAATGGTTTTCCAATTCAGAAGCGGCTTGTTTCCGA
ATGATAAATGAAGACTCAGCCTTAAGAGGTTAGTGATTTTTATCTTGGGATCACATGCCA
CCAATTATGCGTTTCTATGATGAATCAAACTAGCTCACTATGACTTACACAATGTAAACA
TAAGAACACCTGAGAAACTGGAGAAGACTCCTGGGGTTAACGTGTAAAAAACTTTTTACC
CACATCTTTGTCCTTCCTCTAGGTTCTGTCACTAAGCAGTTCGTTTGCTAAAAAGTGAGT
ATAATTAAAGCATGTGTTCAGTGCACAGACATTGGGTGGAGAAAGATGCCTCTGTATGAT
GACTTACATGGAATCTCGTTCGGCTGATTCTTGCTGTTGAGACTTGGAAATCTGATTTTC
TAAGAATAATGGCTTAGGTGGGAACAACCCAAGATGGAAACATTATTTGATCCAGTCTTG
TTTATTGCAGGACCAGCACTTTGCCTGGAGCCCAAGCGATGATTCGAGGTAAATGCCTTT
GCAGCACTGTCTGGCTGCTCTGTGTTTCTTGTTGTTGTTGTTGTTTTTTTTGGGGGGGGG
GGGGGCGTGTCTTGTAGTACTTAGATTTGGAGAAATATAAATGTCTTAATCCAAAGTCTT
GGGCCATTCTCGAGCATCCTTCTCACCAGTGATGAGTTGAATACCGCCCCAGTCTGAAAA
CTATGACTGAAAGGTATTTCTGAGCTGTGAGCCAAAGTTGTAACAGAACAGGCTGGTGGT
TCATTGTGTCCATTGAAATGTTGCTGTGCCTTTCTAAGCAACAAGCCCATGGTTGAGATG
TGATTCCAATCTCATGCTCTTACAGGGAGATTGTTCAGTCATGTATCTGTTGGACTCCAG
TCTGCCATTACAGGTGAGTAAGTAAAGCCATGGGTTAGGTAAAATTAGATCCCCGTGAAG
AAACATTCACATGTCTTACCTTCTGTCCTAGTCCCAGAGCCTGTAAAGGTGAACCCACTG
GGGCTGGCTGGGGGATAAGAGGAGCATTTGTTCCAGATGGAACTGTCTGAGGGATCATGA
GAATTTCTACACATGGGAAAGGGAGGATTTAGTTTTATATGTACCATAAAATAATGTTCT
TTTCTTTTGCAGGAACTCAAATCTTGGAGAACATTTCAAGAATCCAGCCTGGCTGTTCAA
ATTAGAATACAGTTCAGCCTTTCTACTATCTTCAAATAAAGTTGTTTTAACCTTCACTGA
TTTATGTTTTCTGGGTCCAGGTGGGCCAAAGGAAAGTTTTACTGGTAGGTCTTCCGTCAA
AATTAGTGTAGCAGTTTGCCTAATCTGGACTTCTGAGCCCAGGGAAGTAGTTGAGTGCAT
TCTTAAATGGAGTGTTTACTTCTCTATGTGTGTACACTTGAAGGAGAATCCTGGGTGAAA
TTTTTGCTGGGTTTGGTACAACTTAAGCAGTTGTGTTAGCTGGCTTTCATTTAAGCACTT
AGGAGCCAACAAGGCATGGCAGTTCAGGGTACCTTAGACTCTGGCTTTGACAAAGATTCT
GCATATTTAATTGACCTTAAGGTAGTTTCTGTGGGGTCCAGCTGCCTGTTCTAAAGGATG
AGGCCCAGACCTGAACTTCAGAGGCATCAATACCTAAAGGGGTAATGTTTTTCATAAAAT
ATTGCCTGATCGGATTTATGATTTATATTTTATATAATCCCCATGTTAGTATAGTTTTTC
AGTCACTAATGTCACCTCATTTAATATTTGGCCTGGCATTTATTCAATTTACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved