Dasypus_novemcinctus Locus Mono:247:SNORD87
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:247:SNORD87
Dasypus_novemcinctus
Mono:247:SNORD87
scaffold_128128
SNORD87
1001..1092
2092
TTTTTCCTTTTTTTTTTTTAATCTAACCTTTAACCTAGTTCATATCTCATCCTTGTCAA
GTTCTGAGACAGAAAAGCAATGGCTGGGTGCTCATTAGGAACATCATGTGTTAAAATCAA
TGCCACAGGGAAGAAGATCATAAATGTTCCTACCATTGTCCAAGCTAACAACTCATATTC
CAGCTTGGAAAGATCATTTATGGAATTATTAGGGCTTAATGTGTAAAATGTGGGGCAACT
CTGTAATTAGAAAAATGTTTTCTTACTATAATGCTTTTTTCTCCAGGGTATTTACTTTTA
CTGGTATAGCACAAATCATGCACTCACCAAGCCCCTCAATGTGTAATTCTTTGCAATGTC
AAGGACTTAAATTGCTGTAACTCTGATGCATACGTAGTTAGGCACTTAAAGGTTGAGCAC
TCTCAAATATACCCCCAAAATATAGAAACTGCCCTTTTTTTTTTTTTTAATCCTTTTTGG
GAACGTTTTGTACAATGAACCAGAAATGATCAAAGGGACTAACATACTTATATATTCATT
ACAACTGTTTTAAAATTTGAGCTTGTCAGTTTTCACTACCAAAAAGTAGAATTAAGCAGC
AGTCTATTCTGTTGTTCCACTAGAGATGTGTTGAACACAGATAATTACTCACTCCTTGAT
TTAAGTGGTTTGGAGGTCATGAAGGTGCTAGTATGGCTTTGTATGGTTCCTGATAAATAA
AAGAAATTACTATTAGACCATTCTTATAAGATGGCAAACAGATGCAAATATAAATGAGAA
TTCATAATGAAATATATTTAATTTCCAGATGCCACAAAGCCTGAGTTTTAAAGAAGTATG
AAGATGATAATACTAAATGTTTTTCCAAAAAATGATGGCTGAAAAAAAAACAGCTATAAG
AGGTACCTAAAGTTATAATGTGGGCTTCTTTATTTCTTTGTCATATTGTACCTGGACAAT
ACCTGAAGTATTTAATGTTTTTGACATAGATACGATTCAAAACTGGCACAATGATGACTT
AAATTACTTTTTGCCGTTTACCCAGCTGAGGGGTTTCTTTGAAGAAATAAATCTTTAAGA
CTGAGATGCCAGTAATTTATTTATGTGAATTACTGATAAATAATATAATCATTTTTTAAA
ATTAGGTGACATTTTTTTTCTTCTTCAGCATATAGGTAGCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCATGCAACAAT
CTTGGGAAGAAAAATGAATTGGCCAAGAAGACAGATGAATAGAAGCAGATGGAGAAAATT
AGTTTGATGTTGATAACCTTATCTCAGTTTAATACTTACATTATTAATTTCTGAGCAATA
AAGTCTGTTTTCTTTAAAATTGTATCTCAAGTCTTTTAAACGACTCCAAGTCTTCTAGTC
ACTAGTCATACTCATAAAATGTACTTTAGGGATATAAGATCCTGTAATAACTTGCTGACT
GGTGGGTGGTGATTCTCACTGAAATATGGAATGGCATTCTCCTGTTTCCTTGCCTTTGGG
GATTTCTTGTGGTCCCTATCTGGCCTCCCCTCAGAACTTGCTGTTTTACCTATAAAACAG
TAGATGAGGTATCTTAAACTTCCAGTGCTAAATAGCTATGGAATTGTCTATTAGGGGTAA
AGGGTTTTCCTTCTGTAACCTATGGATTCTAAAATTTATACTTTATTCTCTAGTTTGCTG
TCCTCTTGGCGAAGAAAGGGTAGTCCTAATCCTAGGTCAAGTACAATATTAGCAATAAGA
ATACTAAGAAAATAGTAACCATATAGGCCAGACTTTTCAGAATTCTAAAACTGAAAATTC
CTACCTCTTATAAAGTTCCTTAGTTTGAAAATTATTTACTTTTAATCACAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved