Dasypus_novemcinctus Locus Mono:212:SNORA73
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:212:SNORA73
Dasypus_novemcinctus
Mono:212:SNORA73
scaffold_100889
SNORA73
1001..1203
2203
ACAATAAAAGACACAGACTGGGTGCCACTGACAAGAATACAGGTGGGCACAGAAGAATA
TGAAGCTAATGGACACAGAGAACAGACAACTGGGGGGAAGCGGGGAAGGGGAGAGAAGTA
AATAAAAAATAAATCTTAAAATAAAGAAAAAAGAAAATGATAATGGAAAGAGTACAACAA
TTTCTTTTTAAAAAGGCAGTGGGAATGTACATCCATATAACTGATAAAAGAAGTCAGCAT
GTTCTTCTTTCTTCCTATGAGAAGCACAGACAAACATGGTCTTTACATGGGAAATCAGTG
CAGCACACAATTACACCATTCAAAGAAGCCTGTGTCTAACTTTCCTTGCTCATTGTTTAC
CTCATTGCCTACATATTTCTTGCTCCTTACTTGCACAGATATCTATTCATCAGTGCTCTA
TTTCCCTAGAGCAGGGGACTGAATCTGTGAGCAGGAATGAATGGCCCTGTAACAGATGAA
ATTCCAATCCTAAACAGTGCAAAGCATGATTATGACCTTATTGTCCTTCTTTGACATTTC
TCCTTTGAAAACTTGCGCAGATCTCAAGGAATCTTGAGGCATTGCTCTCTAGCTACATGA
AATAGAAAAGCAAACATCTTTCTCTTCATTCTCTCCAAAAGGGAAATCAAGACAAGGTAA
GTATTAAAGAAGGTATAGAATTAATGTAACTCCTTTGGAATAAATTACACAAATTCTGAA
AACACCTAAATGGACAATAGTATAATCATCAATAGGTCACTTTATTGGACAACTTCAGAT
TGAGGAATCAATATTTTACAGGTTCCTCAATCTAATGGGTTCACCAGAATGCTTTTTTCT
CAAAATCATACTTTCTACTAAATCATACTTATGTTCTTTGTGGTTAATATGCTCTATTGA
CAAATCAGTACTTAAAATTTCTTAGAGAAAGATCATTTCAACTACTTCACTTGATACGTA
AGTACATGAGTATACAAAATACTCTTAAAAAATATATTGTCCCAACATGGATACCCCAGG
AGGTCACTCTCCCAGGGCTCTGTCCAGGTGGTCTTATGAGCATAGGGTTCTGCCCGGTAA
CATACAGTCCCATTCCATGACATTAGAGATGAAGCTAGGCCTCAAGCCTGCACCTGCATA
TTTCTACAGCTTCTCAGAGTCCTGCAGACAATGACTGAGGAGACAAACCATGCAGGAAAC
ATATCTCATATTAAAAATTAAAATAAGACCTTAAATAGGAATTTTATGTGCATATATAGA
GAAAGAGAGAGTTCCCATTCCAAAGTCAACACTTTGTCCATTCTAGTATGGTCTCCACTC
TTGATAAGAAAAAATTATTTCTATCATCTAAACTTTCACAACGACTTATCAAATCTTTCT
TTCATTCTTCTCCTAATTCTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved