Dasypus_novemcinctus Locus Mono:432:SNORA1
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:432:SNORA1
Dasypus_novemcinctus
Mono:432:SNORA1
GeneScaffold_7112
SNORA1
1001..1135
2135
TTCTGAGATACTCAGCTCTGAGACATATGCATCCTTTTATTCCCCAGGATCAAGAACAC
AGATCACCTTCAATAAATGCATGCAAGTATGAGCTGTTCTCCCCACTCTACCCCTAACTG
TAAGGAAGTTGTTGCTGTAGTTGTCATCATTGTTTTTAATCAGAGCCTGGGTTAACCTCA
ATCTCTGAAGCCTGCATCTGGCTGAGATATGGACTTTGTATGACATATGCCTGTGCTGTG
ATTCATATTTCACTTAAATCCCACATCAATTCTACAGCAGGGAATGTTGAAGAGGAAATG
GCTGTCTACCCTAATAAGCACATGGCTGCCAACCTTACCTTCTGAGTCTGTTCCTTCCAT
GGCTCTTTTTGTAGCAGAAGAGGTGTGCTACTTGGAAGGAGAGCGTAAGCCTCCTGCAGA
GTGACCCTGTGCATTCGACTCCTGCCGAGGAAGCTTGATGCTGGTCCAGCCGAGCCATTT
TCCTGATGCCATGGCAACCAGCTGGCACTAAGGCCAAGGAGGAGAGGGGCATCGTGGTCT
GCCCATGCAACCACTGCTGTTGCAAATATCAGCAACAAGAAGTCCAGAGCCTAAAACAGA
AATAGAAACAAGGCTGAGTCACATGTCATAACAATTCAAGAAACATGTTCAATGAAACAG
TCCATCATGATGAAATGTTATCTTCCCCTGCATTCAACTCTTCCTTCTTCTTACCCCAAC
CCCAGAAGAAGAACAGGGACTGAAGAGCTAACTCTATTTTCAAGCTTAATAAAGAGATAT
ATTAGGGCTTTGGAAGGTCATCAGGGGTCCCCTTTTCTAAAGACAGTTATGTCCAACAGT
TTCATTATTTCTCTAACACTTCAGGAGAAGTATAATTTATTTAATTCCTCATCACACTGA
GATCCAAGCACTCCTCCGTTCTGGTGTTTGCAAAGAGATTAAGAAATTAAGAGTGACATG
GAGAAAGATATTTAGATTTAGTGTGATGTGGTCAAAACTGATTTTAAAAAATATGTGAGA
ATGGGCACAGTTGATCGTGGTGTCCAGAATTGATAAATGTGGCTAAATTGAGACACAGAT
TATGCTTCCACCAGAGTAAATTCATTGCAGTAGTGACAATGAGAACTGTAATTTTTTTCC
CTCGAGTCATGAGTTAAAAAATGGATGTTAGCAGATTAAAGGTTAGTACATTTTAGATCA
TTTGCCAAAATATAAATGTACTCTTTTCTAGGGACCTAACGTGAATAACACAAAGAAATT
AGGATCCAATAATTCTAGAATTAATAAATAGGTGGGGAGTTTCTGAAGCATACATCCGTT
TGTCCACACACAAGTGGAGATGAAAAGAAGCCCATCTAAAAGAATTATGACAAGGCTGAC
TGGAAACAGTTGTGGATTCTTTTCAAGAGGGCTATCTTGAATAAATCTTGTTTTCAGCTT
CAGAGGAACTAGGCTGACTTTGATAATTAAGCAGTGGAATGATCACACATTGAATTCCAT
AAATAAAAAATTTATTACCTTAATTTGCTACATATATTAAAAATACTTTTACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved