Dasypus_novemcinctus Locus Mono:287:SNORA36
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:287:SNORA36
Dasypus_novemcinctus
Mono:287:SNORA36
scaffold_172495
SNORA36
1001..1133
1397
TATGCGCTTCTGTGAGCTACACAGAGACCATTCCAAGCCCTTGGTAGCATTCTATACCA
TAATTCAGTTCTCAAAGCTTCTGCTGTGTTAATTTTGGTTATTTTCACATATTGGCTCCT
GAGGGATGAGGGCAGTACTTCACAGATATTTAAAGGCTCCTTTCTATTCTGACTTTCTGT
TAGATTCAGAGAGAGATGTTGCTTTTGTTAGCATTTTCTTAGTGAAGGACTCAGATAGTC
CCAGAGCTCCACTTGCTAGTTTATGCAGCAGCTGAACCAATGGGCAAGGGAAGAGGATAC
ATATTTTGCTGGTGCTTGCCTATACAGATGGAAACAGTTGAGAGGATTCCGTCCCACAGT
TTCTTTGGCAACAGCAACCTATGGGGAGGAACAGGACTATCCCTTCTTTGTTGGCATTTA
CTACAGCCAGCTAGGCCAATCAAAAGGGCTCCTTCCAATAAGTCTCTTTTGTTGCATTGC
CCAGAGAAATAATGGTGGTACAGGCTGTTTGCTATCATTTTAATTGCTTCTTTTATGGCA
TTAGTAGAGCAGGTGTAATCAAAAGGAATCACTGCAGTAGGGCCTTCCTATTTCCTATCC
TCTGACCGGAGAGCACAGACTCTTCCTCCCCCTACCCCCACATTTTTGTTCTTTTATGAC
TACACCCGTTAGCACTTCTGGATTTGGGGTTTCTCTAACTTAGATTTTCTCTAGCTCAGA
TATAACATAAACAGTGTCACATGATATAATCAAACTGTTTTGTCAATGCTGAAAATTTTA
AGCTTTGTTTTCTCACTACACACATTCATTCAAACTTCGTACAAGTTAAATAATAATTCA
AGAGAGGTAGACCATTTTTGTAACAAAATTAAAATAAATCTTAAATCAGTTCATATTTTC
TTACTGTCTTTGACTACTTTAGTCTGGCAATTTTTTTTTCTGCTGACAAATATTTTCTTG
TCACTGAGATTTTTTTCTAACTTTCTCAATATGACAGATTATTCCAAAGTGTTGAGTTCA
GTTCACAGAGGCTTCCCTGTTCTATTACTTAAACTTTGGGAAATTGAAATGGGACAGGGT
AAGTGTTTGGATAGAAAAGTACTGTTCTATTCATTTATGTCCTGGCATGCACAATGAAAT
AAATTAATTAATTAAAAAATATGACAAATTTGAATTTTTAAACATAATTCATTCACATTA
TATCTTAATTCCTAGTGACAGGAATATCATTATTGATTTCCCAGTGAATATTTTTTTCTT
GTGATCACCTTTGTTTATAGATTATATGTAGTTCTTTTAGATTTAAAAAGAGAAAACTTT
CATTTTTACTTTGAAGGAAACCAGCAACTGATTTATAGTGACAAAATTATAAGAAAACTC
CAAATAGATTCAGATGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved