Dasypus_novemcinctus Locus Mono:303:SNORA29
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:303:SNORA29
Dasypus_novemcinctus
Mono:303:SNORA29
scaffold_198822
SNORA29
1001..1135
1612
ACAGGACAAGCAGTGAATCAAGAAATAAGCAACTTAAAACTACTAGGATCATCCTATTT
GACTACCACTTTTTTTTTTTTAAGATTTATTTATTTATTTACTTCTCTCCCCCCTCCCAC
CTTGTCTGTTCCCTGTGTCTATTTGTTGTGTCTTCTTCTTTGTCTGCTTCTCTTGTTGTT
AGCGGCACTGGAATCTGTGTTTCTCTGTATTACGTCATCTTGTTGTATCAGCTCTCCATG
TGTGCAGTGCCATTCCTGGGCAGGCTGCACTTTCTTTCGTGCTGGGCGGCTTTCCTTATG
GGGTGCACTCCTTGCATGTGGGGCTACCCACGTGGGGGGCACCCCTGTGTGGCACAGCAC
TCCTTGTGCGCATCAGCACTGCACATGGGCCAGCTGCATACGGGTCAAGGAGGCCTGGGG
TTTGAACCGCGGACCTCCCATGTGGTAGACTGACACCCTAACCACTGGGCCAAGTCCGTT
GCCTGTACCACTTTTTCTTTTAATAATGGATTTTAGTGGCAGTGCTTATAGGATGGATGA
AAATTGCCATGATCTGAAGAGGGAGGATTTTGTGTGTGTGTCCTCCTATATGAAAATGGT
GGACAGGAAACTAGTGCCTGTGACATTTTGATTCTACATGCTAAATTTGAATTAGGTTAA
ATAATAAACTTGCAGGTGTTTCCTCCCCACACTTTAAACAGGGAAGCAATGCATTATATC
AGGGAATACCTGATTATTAACACAGATGAACTTGGAAGAGATTGCCTGATTACTGCTGAT
AAGATATCTATGTCTTCCAAAATCATTGGAATATATCCTGGTGATGGTCCAGTAAAGTTT
GGGCTTATTTTAAAACAAAAGGAAAAAAAGTACTAGGATCTCATGGTGCCCTGGCAGGCT
ACTCTCCCATTCCCTCAACAGTTTGATGCAGAGCTGGCCCATGTTTTCAATGCAAGTCCT
TGATCACTTCTGGAAGGAGCACAGTAACCATCATACATATATTTGGAGCATGTATATCTG
GCCCAGTCTCTCTGGTTGTGACCTGAAGGAAGAAATCAGGACAATCATTGCAGGGTTGCC
TTGAATGTAGAAAACAACTCTACCATAGAACACTGTGTGAGAGCAGTCAAGTTGTGGCTG
CCTGGAGCAAGGGATTACTAGCTTAAAGACATAGTGCAGTGCCCCAGACTGTAAGGAAAT
TGTTTTATAGAGAAGAGGAGATATATGTATTGTGTAAATGGGGAGATTCCTAAGGCAAGA
TACTTTGGAGGCCCCTCACACTGGCCTGGAGCTATTCTCTAAACTCACTGTATGGATAAA
CTTTGTCTGATAAAGAGCACTGGCACAGATCAATCTGGAAAGACCAGGAAAGTTGTTTTA
TTTTTTTTTCTCAGTTCCTGGTATATAAGGAAAGCACTGTCATAACACTAGCTGGATATA
AGCTTAAAGAACAGATGCCTCAGTGTCTAAGTTCCAGCTATAACACATTAAAATATCGAA
ACGTCTAGGTTTCAACAAAAGATTGCAAAACAAACAAAGAAACAGGAAGTAGTGGCCTAG
GCAGAGGTGTCCCAAATATGGTGAGGAGCTGTCCAAAATGACAACTTCCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved