Dasypus_novemcinctus Locus Mono:187:SNORA26
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:187:SNORA26
Dasypus_novemcinctus
Mono:187:SNORA26
scaffold_80752
SNORA26
1001..1112
1788
TAGGTGTACAATGGGGGCATTGGAATTGTCCTGCATGACATTGCAATGATGGATACAAG
CCATTATACATTTTGTCATAACCTATAAAATTGTGGGGGGCAGAGTGTAAACTGCAATGT
AAACTATAGTCCATGGTTAGTAGCAGTGCTTCAATGTGTTCATTAATTGTAACAAATGTA
CCACACTAATGAAAGATGTTGTTAATGTGGGAAAGTGTGTGTGTGTGGGGAGGAGTGGGG
CATATGGGAATCTCCTATATATATATATATACATACACGCACATATATTTTTAAAGATTT
ATTTTATTTATTTATTTTCCCCATCCCTTTGTTGTTTGCACATGCTGAGTCTGTTTGTCT
TCCTTGTTTCTTTAGGAGGCACTGGGAGCCAAACCTGGGATCTCTGATGTGGGAGGGAGG
TGCCTAATCACTTAGGCTACCTCTGCTCCCTGCTTTGTTGTATCTCTCATTATGTTTTTT
CTTCCTGTGTCTCTTGTTGTGTCAGCTTGCCGTGCTTGCCCATCTTTCCAACTCACTGTC
TTCTTTACGAGGCACCAGGATTGATCCCAGTCGCCTGAGCCATATCTGCTTCCCCCTATA
TTTTTTATGTAACATTTATGTAATCTAAATCTTCTTTAAAAGAAACAACCCCCAAATCCC
TTATCACACCCTTTCCTGTGCCCTTTTAAGGTTGATTCTGTATTTTAAGAGGCCCACACA
GAATGGTAAAGTAAGCCTCCATAAAACCTGGAGAGGAGATCCTCTTTGGATTTGTCTGAA
GTCACAGCTGAGAAGAGAAGGGGAGGGGAGGGGAAGGGAGGGAAGAGAGGGAAGGAAAGG
GGTCATTAAAATGAGGGTCTGTTTCTGAACTCTCAATTCAATTCCATATATCTCAATATA
TAATTCCATATATATTCCGTGTATATATTTATCCTTGTATCAGTATGAGTCCTCCAACTT
TGTTTTTTTTCGGGGTGGCTTTAGCTATTTGGAGTCCTTTACCCTTCCATATAAATGTGA
TGATTGGCTTTTCCATTTCTGCTAAGAATGCTGTTGGAATTTTGATTGGTATTGCACTGA
ATCTGTAAATTGTTTTGGGTAGAATCGACATCTTAACAATATTTATTCTTCCAATCTGTG
AACATGCAATGTCTTTCCATTTATTTAAGTCTTTTTTGGTTTCTTTTAGTAATGCTTTGT
AGTTTTCTGACTGCAGTTCTGTAATAGTCAGTGTTCTCTAGGGAAACAGAATCAACAAGA
ATTATCTGTCAATAGTATGTGATTTTATAAGAGTCTCTCATGTTACCATGGGAATGCACA
AGTCCAGGTTCTGCAGGCAGGCTGCAACCAGGGGCTTCGATGAAAGTCCAGTGAAGGTTC
TTGATGAGTTCTGGGAGATGTTGGCTCTCCAAAGATGAACTGGGAAATTTTCACTCAATG
CTGGAATCACTTCCCCTTTTAAGGCATTCAACTGATTGGATAAAGCATCAGTCATTGCTG
ATGGCAATTTCCCTGACTGATGTAATTGTAATCAGTTATCTGACTTACCACTGCAGTAAA
GTCAATGGTGATGAAAGTCCATAAATGCCCTTGTATTACAGTTAGCCCAGTGGTTGCTTG
ACCAAACAACTGGGCACCTGGCTGAGTTGACACATTAGCCTAACCATCACAGGTTCCTTT
ATAAATTTATGGTTAAGTTTATTCCTAAATATTTGATTCTTTTAGTGACTATTATAAATG
GAATTTTTTTCTGATTTCTCCTCGTCCTGAGGCCAGAGAATTCAGAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved