Dasypus_novemcinctus Locus Mono:55:SNORA19
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:55:SNORA19
Dasypus_novemcinctus
Mono:55:SNORA19
scaffold_18888
SNORA19
1001..1126
2126
NNNNNNNNNNNNNNNNNNNTCTGTCTCTCTACCTGGGTTTCTGCTGTGTCTAAGGGAGC
TGTTTCTAGTCCTATGCGTTCTCCTGGCTCAGGTCCTCTCTTCCTGGAGCTAGCTTTTCT
CTCCTTTGTGTGCAGATTGCCTGGGGCTCCAGCTTAAGACTTCAGCATATCACTCCATCC
TCAATAAAGACAACAATAAGAAACCTCAATTCTCTCCTTCGTCCCCCTCTTATCTGTGAG
TCCCCACCACCAAGTGGACCAACGCTCTAATGATGTGCCCCACTCAAAACCCTGGTGGTA
ACTTACTCATGCCCAGCTACAGTCCCGATTACAAACATAATCCAATATCTATTTTTGGAA
TTTATAACCATATCAAACTGCTACAGCATTTATATCTAATTGTGCATACTTCATTATATG
GGACTTATAATGGGTTAGTTTATGTTCTGAAAAGTAATAGTAGAGGAAAACACTATATGG
TTGGCACTCAGGATGCTGTCAAAAGCTCTGCAACCATGGATCCAAGCACAGGACTCCTTT
ACATTGGCTCTCATGACCAGCATGCATACGCTTTGGATATTTATGTGAGAAGTCACTTCC
TCAGTCTCCCACACTATAAGCATGGAAGAATATGGAACTGGGGTGTGTTGTTGAGTCTGA
GAGCAGGTGTTAACCACATCCTAAGTTTAGCATTGTAGACTGGAAACAGTTCATATCTTA
GACATTTTTAACTTCCTTACCAAATTTTCCATAAATAAATTAGCTACTTAGTGCTTTGAA
ATGTCAAGATCTTAGTATTATCATCTTGAGAAAAGAAAAAAAAATCACAAAGGAAAATAT
CAATTAGACTTGATGATATAAAAAAAATTTATATATGACAGGAATACAAAACTAAATGAA
ACAAGTTGGGAAAAATATTTGAAACAAATGTGATAGTTAAAATGCACTTATATTTATAAA
GTATAATAAAAAGCAAATACAAATTAATAAGAAAAATATCATAGCACATTTCATTGACTT
GCTTTCTTTTGTGTGAGCAGTGTTATTTCTTATGTACTATTCAAATAGTTGAAGGGTAAT
TAGCAGTATCACTAAATAGTAATGCTGCCAGTCGTCTTCAAACAAAACATAAAAAATAAT
ACATATATGAAACCTGATATAAAAATAAAAAAGGGACTTAAAGTGCACAGGTCCCTAAAG
AAGAATGACTCGTAAATATATTTAAATGTTTCATACCCTTAGTAATCAAGAACTATGAGA
TAGACAAATAAATGGTTTTAGATTAGAAAAAATATTAAAGTGATAATATTGAATGCTGTT
GAAAGTGGTGGGAGGTTATAACTGGTGGAGCCTCTAAGGAAAATTACTTGGCAATAGATA
ACATTTTTTATACCTTTGATCCAGTAAAATTTGTCTAGGAATTTATCCTGGCAAAAATAA
TCAGAAAACGGACAAATTTATGCACTAAAATGTCCATTTCCAAGTTATTTTTAATACTAA
GAAATGAGTTCCAAATGATGTTCAATAAGGGAGAGAAATTATCTTCTGTTCATTTGAGAT
ATAGTGTACATTAAAATTATATTTAGATTGTTTTACAAAATAAGTGAGCAAAACAAGATA
TCAGTTGGTATATTCAGAATGATCTCAACTATATTAAATCATGTTTACATATACTGGGAA
GATCAGAGGGAAATGGCTAAAATGTTAACAGTATTTTCTCTGGGTCATTTTTATACTAAG
CTTTTGTCTTCTATATACATTGTTCTCCACAATGGGCATGTATTACTTTTATTATAAAGT
ATACTAAAAATTAAAAGTTATGCTGTATGTAAATTGACATCAGTGGATTGTATAGACATA
ACATCATGAGGAATAGAATATATAGATTTGTTATCCGTTAGTGAAAACCAGTTCATTTTG
TCACACTCCAGAGATAATGTACTGCGCTGGAGATTTGAGAATGGTGGAAGGCTTGGGGCA
GGTGGCAGCATGGCCGACCATGGTTGTATGGGGCAGGGGTACGCGGCCTTCCTGAGCTTG
GCAGAACTTGAATGAATCTCACCAGCTTTGCTGGAGGAGGATGGGTAGTTGAAGCATAGG
CTGCTGTTAGCTTAATATTTGGGAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved