Dasypus_novemcinctus Locus Poly:19:SNORD55
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:19:SNORD55
Dasypus_novemcinctus
Poly:19:SNORD55
GeneScaffold_2490
SNORD55, SNORD46, SNORD38
1001..1080, 1591..1694, 2499..2570
3570
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAACTTGCACCATACGGTCGACACGCAT
GATCCACCCGAACTCGGAGATTAGGCGGGCAAGAAGCTCCGCAGCGGGCATAAGCCTCCA
GGCCCCGGACCTCGCGGCGCTGTCGCACAGACGTCAGTAACATCATACTCCGTCCCCAGG
CCCATTTTAACGGCGCCCGGAAATGACGTAAGAGGGCGGGACAGTGTTTTACAAACGGGA
CCGTGAAGCCTTGCGTTTCCTCTTTCCAGCCAGCGCCTTGCGATGGGTGAGTCTTTTTCT
GTAATGGGGTCAGGGTGAGGGGATGAATTCAATCTGGCGCCATCCAGTCTCGCAGCCAAG
TTAGGAGTCCGGGCGCCTTGACCCCAGGCAGTGAGCAGCCCTTAAGAGGGGTGGTCTTCG
GGTTTTGGTCGCCAAGGTCTGCTCCTGGGGCTGCACGGGCTCCGGGCTGCGAGCCGTACC
AACATGGCTGCCGCGGGAAAGGAGGACCGGGCTGGGCCGCGCGTCTAGGATGACACCTCG
GTGATGCTGCAAACCCCCGAGTGCGCAGTGGGGAAGCCAACCTTGGAGAGCTGAGCGTGC
AGCCCGTCCGGTACGGGGGTTCTGGGGCTGGCGAGATGCCGGCCCTGGGTCCCAGAGGCC
CAGGCGTCCAATCCCACTCTCTTACGTAGGCATCTCCCGGGACAACTGGCACAAGCGCCG
CAAGACCGGGGGCAAGAGAAAGCCCTACCACAAGAAGCGAAAGTATGAGCTAGGACGCCC
GGCTGCCAACACCAAGGTGCGTGCGTGGGCTTCACCGCCACGGAGGACGCCTTCCCCCGG
CCGTCCGGCGTGGTCAGGTCTTGGCGCGATGTGGGTTCTTTGTCGGACACTTGATGACTT
TATTTTGATGGTTGGGACTGGGCGGCCTCCCTACCTTTACGTGTTGGGTAAATATATACT
AAATAGAATGAGTGCATGGTCTCGGCCCTGGGAGCTTGGGGTTTAATAACTTACTATGGC
TTGGAGGGAATGGGCCTCGCATGGTAACAGCCTGTTATTTTTGTTGCATACAATGATAAG
TTTCAAGTGTCTGGGTTTTCTTGTGGGAGGTAACTAGAGTGATGAAAAAGTATCCTTAGG
CGTGGTTGTGGTCGTCTTGGTCACATATGTGCCACTTGCCTATGCTAGGACCTGTCATAG
TTACACTGACTGTTATCTCCACTCATCCTATACTCCCCTTCCTCTCTTCTGTTCTTGATA
ATCTAGTTCTTGTATCTCCTTGTTTCCCAGATTGGCCCCCGCCGCATACACACAGTTCGT
GTCCGAGGAGGCAATAAGAAGTACCGAGCCCTAAGGCTGGACGTGGGGAACTTCTCCTGG
GGTTCTGAATGTGAGTGAGGCCCTAAGGGAGTGGGTGGCAACTTGGCACTAAACTGCCCT
AAGTCTCAATGGCTTTTAACAGGAAGCCTCTCCCAGTCAAGGTCCTTAAGGATACTGTTT
CTGAAAGATCTTGAATTATCTAGAGTTCTCTCCACCTTGACTGTCCTGCCCTAAGCTCTA
AACAGTTAAACTCCTGTGGTCTCAGGGAGTGGTGCTGAGTCAAAAGACTTTGTGGAAGAC
AAGCTGAATGCCCCATGGCTGGGTAAAGGCTCAGAGTTCGTTTGCTTCTCCCTGATAAGA
GAACCTCCTTAGTCCTTACTAGGGCAGAAAAGCTTGGGGAAGAAGACAAGGCCAATTGAC
TTCTTGTTTGCATGACTTGATTGTGAATTTCTCTTGTGAGCAGGCTGTACTCGCAAAACA
AGAATCATCGATGTTGTATACAATGCATCCAATAATGAGCTGGTCCGCACCAAGACTCTG
GTGAAAAATTGTATTGTACTCATTGACAGCACACCGTACCGGCAGTGGTACGAGTCCCAC
TATGCTCTGCCCCTAGGCCGCAAGAAGGGGGCCAAGCTGGTATGTGTTTGGGGAATCACC
CCTGTAGGGGCAGAGGGGGGAGAGCAGCCTTATTCCTGCCTTCTTGTGATGAAAACTCTG
TCCAGTTCTGCTTCTGAAGGGAAAGAGATGAAGCATTTAGTGCTGAGGAAGGCAAGGGGT
GGGTTTTACAAGGGTTCAAGAAGGTTATCTATAGCAGCCTTCCTTGAGCTGGGGTGTATG
GCTGGGGAGTCTGTCTAACCCATCTGTCCCCTGATTTATTCAGACTCCTGAGGAGGAAGA
GATTTTAAACAAAAAACGATCAAAGAAAATTCAGAAGAAATATGATGAAAGGAAAAAGAA
TGCCAAGATCAGCTGTCTTCTGGAGGAGCAGTTCCCAGCATGGCAAGCTTCTTGCATGCA
TTGCTTCAGGGCCAGGCCCAGCATGGCTAACAGATGGCTATATGCTAGAGGGCAAGAAGG
TGGAGGTCTATCTGAGGAAAACCAAGGCCCGGAAAGGCAAATAATTCCTTCCTCCCGTCC
TAGCTCCTGTAATAAAGTTTATTGTTCTATAAAAAAAATGGCAAAGGATTTGACTAGATA
TTTCTCCAAAAAAGATATACAAATGGCCAATAAGCACATGAAAAGATGCTCCATATCATT
AGTCATTAGGGAAACACAAACCAAAACTATAACAAGATACCACTTTATACCAGCGAGGAT
GGCTATTACCTTTAAAGAAGAAAATAACAAGAGTTGGTGAGATGTGGAGAAACTGGAACC
CTTGTGCATTGCTGGTGGGAATGTAAAATGGTTGCAGCCACTGTGGAAAAGTTTGGTCTT
CCCTCAGTTAAACATAGGATTGCTACTCCTAGAAACATACCCAAAAGAAGTGAAAACAGG
GGCTCAAACAGATATTTTTATGCCAATGTTCATAGCCACGTTATTCACAATAGGCCAAAG
GTGGAAACAACCCAAGTATTCATCAACAGATGAAGGGACATAGAATATAATTTGGCCATA
AAAAGGAATAAAGTTCTTATACTTGCTATAAGATGGATGAAACTTGAATATATTATGCTA
AATAAAACAATTCAGACAAAAAGGTCAAATATTATATGATTCCACTCATGAAATATCTAA
AAGAGGCAAATTCATAGAGACAGAAAGTAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved