Dasypus_novemcinctus Locus Mono:296:SNORA76
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:296:SNORA76
Dasypus_novemcinctus
Mono:296:SNORA76
scaffold_187909
SNORA76
1001..1112
1653
AGTTCACAGTTAATTTTGTGTGTTCGGTAGTTTTGGCTGGGCTCAGCTGAGTGGTTCTT
CTGGTAGTCTGTGCCTGACTTGGCTGATCTCGGGGGACCTCACTCATTCATCTACCTTCA
GTGGCTGGGTCAGCTGGCTGGCTGACTATTGGCTGGATTATCTCAGTCATTCCATGTGGC
CTCTCATCTCCAACAGGCTAACCTGAGCATGTTCACATGTCACTGGAAGAATTCCAAGAG
AAGAAAGCCCCTCTGCAGAAGCATTTGGTGTCACCCCAAACCCTCTGGACTTTTCCCATC
ATAGCCCCAACCATTCTGCTGGTGCCCCCCCACCCCCATTGCTCCCCTCACCATGCTGCC
TGTGCCTCCCCCATCACGGGCCCAAGGCCTCTGGGCTATCCCTGTCTCATGATGAGTCTC
TTTTCCCTGCTAGACTTTGAGCCCCTTGAGGTCAGGGACTGGATCTGTCCTGTTCACCAT
TACATCATCAGATCCCAGAATGGGGCTGGGCTTAGAATGTGTGTTGAAAGACTGGGTGTC
ACGTGCTGCCTTTGAGCCCACAGTCGCACCTGCACGTGGTGCTGGGGGTTAAGCTGCAGC
ACCATAGCACGTGCTTGCACATAACTGGGGCTGCTTTAACTGCCAGCAACAAGACCAAAA
GAAAGAAAAGAAAGAAAGAAAGACTGGGTGTCTTGGAGCCCTGGGGTTTTCTAGGGCTTT
TTTTTTTTTTAAGATTTATTTATTATCCCCTCTTCCCCTCCTCCCTCCCAGTTGTTTTTG
CTGTCTGTGTTTGTCTTCTCTTCTCATTTTCTCTCTTTTAGAGTTCACCTGCAGACCTCT
GATGGGGAGAGAGGTTCCCTGTCAATTGTGCCACCTCAGTTCCTGGTCTCTGCTGCACTT
CACCTTGACTCTTCCCCTTTGTCTCTCTTTTTGTTGCATCATCATCTTGCCACGTGACTC
ACTTGCGCAGGGCACTGGCTCACCACACAGGCATCCATTTAGGCTTGCCACATGGACAGG
CTTTCTCTTCTTCTTTTTCACCACGAGGCCCCAGGGAATGAACCCCGGTCCTCCCATATG
GCAGGCAGAAGCTCTGTCACTTGAGCCACATCCACTTCCCTCCACTATTCTTAACAGATA
TGTGTTAAACCTAAATGGAGTACCAACAAGCAAGAGAACCTTTAAAACCAGTAAACGGAA
GGATCTTAATTAGAAAAATATCCAAAGGTAGAAGAATAATAATAGAGCCAAGTCGATTGA
AGGGGGAGAGGAGTACGACTCCATCTGGCAGCATGCTATTGCACGCACTCACCGCTTGGT
GGAGCTATAGAGGAGAGAAACCCTGTGCAGGCTTATTTGCATCCTGGAAAGAAGGTGCTT
GAGAAAGCCATTTAGGACCACCTGGATTTTTCTGAATGCTATTTAGGAAGCATGCAAGAT
TTTAAAATGACTTTCGTTTTCCCCTTTAGTGAAAAAGGATCATATAGCTAAATCTTTTCT
CCTATTTTTTAGAGCAGGGGTTCTTCTTAACAAGGGGTCCAGGAGTTTGAATTGAAATTC
AAAACATTATTCTTGTGAGGACATGTTGGTGCAGTTGTGATCTATTTATTAAATAATACA
CAGTATAGTGTGGACTTGTAAGGGGTTCGTGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved