Dasypus_novemcinctus Locus Mono:331:SNORD60
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:331:SNORD60
Dasypus_novemcinctus
Mono:331:SNORD60
scaffold_251703
SNORD60
1001..1083
1528
GGAGTCTGATTGGATGGCCTCTGTCAAAGGGTGGAGCTTCGTGGTATCGGGGCCGGAAG
ACAGCCCCAGAAGGAGAAGCCGTGGCCCGATTGGTGGAGACAACGAGGGTAGCGAGCGAG
CGTATCAACGGCGAGGGAGGGCAGGCATTTCCGAGAGGATTGCCCAATCACAGATGGATA
CTTTCTATAAAAGCCTGAGAGGCGCAGGCTTCCTGTCTCTCAGGTCGGGCTCCGCGTGGC
TGTTGTTGGTTCTTGTCTGTACCTCTGCAGGCCGACGTAGCCCCCGGCTCCAGCCTGGCT
CTGGGACGCGCGCTGGTCCTGAGCGCTGTGCAGGACCCGCGACCCCCACGCCCTGTACCG
GGTTTCCGACTCGGGCCGCGGGCCTCCAGCCGTGCAACAACCCACAGGTAGGCGGGCGCG
GGCCTGATGGTGCCGACGCGGGGCCGAGCCTATGATGAATTGCTCTAATTTCTGACACCT
CGTATGAAAACTGCACGTGCAGTCTGATTATTTTGCAAAGCTGAGGCTTCAGGGTGCGTC
CTGTGGGCTGCGGAGGGGCTGGGAGTGGAAATGGACCTCTCTAAACGGCATCTCGGCGCT
GTCTTTTAGGATCCATCGGCGGCCGGCTGCGGACCGGAGCGGAAGCTCACTCTCTACGCT
CGAGGCTCAGCGGGCAGGTGTTGAGGCGGGCGGGAGCAGGGAACAAGGGAGGGCCTTAGA
AAGTCCCGCGGGCTCCCCACTGGAATGGCTTCTTGGGAACTGGGACGAGCTCCCCCACAC
ACGGTCTAAAGAGGAAGAGACTGTCTTGTTCTGCAAGAACTGTGGGGCCACGGTATAAGC
TAGAAGAAGACTAGGAGTGGCCGTTGACTGGGACTGTTAATATAATCCCATACTCCAGTT
AGGTCTGTGTAAGAGGGAAGGAAGATGATTAGAAATCCTGTGTTGAATTTTTTATGGCCC
TGTACCAGGACAATAGCCGGAGGGGCTCCTGCCCATGGTGCTGTGAGCAAGGAGAGGCCC
CTTCTTAATAGCGTACCTCCTTATCGAGATGGGCAGTTTAGGGAGTGAAAGGACGAACCT
GGGACCTGGCAGAAAAGCATGACTGTGAAGCATGTGGCCATGGAAACCCAGCACACCCCC
CCACCCCCTACCACCACCAAAAGGCAAAAGGCGGCTGGAAGAACCTCAGGAGATTTTCCA
TTTGGAACTGGATTTTGTCTGGAATCAAGGAAAAGCCCTAGATATTCTGAAGGGGGCTTA
TCATTGCTTCCTGCCCCAGCAATTGGCAGGTGGGATAACCGATGGAAACCACAAACAGCC
AGGACTCTTCCTAACATTAACAAGTGGAGGAGTAATTAATGGTTTAAAAAGGAACCATGA
GTGCTCTCTTTCTGCCTGGACTAGCCTGCAAGTATACCTGGGACCTATAATCTTATTTTT
TCCCATTTCTATTATCTTTTCTCAGGTCCTTAATAAAATACTGGCTCAACTGAACTGGCA
TGGTCTTAAATTCTTTTATGTAACATAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved