Dasypus_novemcinctus Locus Mono:11:SNORA63
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:11:SNORA63
Dasypus_novemcinctus
Mono:11:SNORA63
scaffold_5650
SNORA63
1001..1113
1754
TATTTGGGGTAGGAGCTTACAGATACCAGACCATAAAGCATAAATTATTTCCCTCACCA
AAGCCTATTTTTACATGTTGGAGAAAGATGGCTGCTGACGTCTGGGAGGGTTCAGGCTTC
CTAGGTTCCTCCCTTCCAGGGTCTTGCTTCTCCCTGGGTTCAGGTTTCCTCTCTTCCCAG
GGCTTGCTCCTTCCTGGGCTCAGTGTTCCTCTCTTCCTGGGGCTTGCTTCTCTTTCCTCT
GTGAGCTTACTTCCCAGGGCTTCAGCATCAAACTCCAACATCAAAAAAACCTCAGCTCTG
TCCTTTGCCTTGCCTTTTATCTGTAAGTCCCCACCCATCAATGGGTGAGGACTCAACACC
CTAATGATGGGGCCCAATCAAAGTCCCAATCATAACTCAATCACGCCCAGATACAGACCA
GATTACAAGCATAACCAATCTCTATTTTTGGAATTCATAACCATATCAAACTGCTACAAT
GAATATAAAACTTTTTCTTATATGTAAAATGCCAGATAATACATATTTTATGCTTTATGG
ACTATGTGGTCTTTCTCACAATTATTCAACCCTTCCATTATAGAAAGGAGTTATAGATGC
TATGTAATTAAATGAAAGTAAAAAAAAAAAAAAAAAGAATGCATTCCAGTAAAATTTTAT
TTACAAAAACAGCCTCCTGCTAAAATAAAGTTGTTTCTTATCTATCCCTGTCTGCTGAAC
TCTCGTAGCAGCCAGGGATGCTTAGTCTCATACTTGTTGATGAGATAGAAGAAGAAAAAC
AAAACAAAACAAAATGTAGGTGGTAGGGTAGCAGGGGTGGCTCAAGCAGTTGAGTGCCTG
CCTCCCACATGGGAGGACCTGGGTTCAGTTCCTGGTGCCTCCTGAAAAAAACAAAACAAA
ACCCCAGCAAGTCAAACAAAAAAACCAACTCAGGGAACTTGATGTGGCTCAGTTGTCGAG
CGCCAGTGTCCCACATATGAGGTCCCAGTTTCAATGCCCAGCCCCTGGTACCTCAAAACA
AACAAATAAACAAACAAACAAAACAACCAAACAGGTTGCAGGCTGGATTTGGCCTGTGAA
CTGTGGTTTACCAACTCTGGTATATGCAATAGGGTAGCCTATGTGACTTTACTGAGAATA
GCATACATGAACCTATGAACTGAATGAGGTCTAAATTACCAGTTAATTTAGATGACTGAT
AATTAATAATGATTACTGCTAAGTGGCTAGATAAATGAAAAAAAGTAGTCAGCTTGAAAA
GAAGGTAGACTATGACTGCTAAATTTTCTTTCATATTTGTTTTCACTTTGAGCTAATTAC
CCACTTTCCCACTGTTTGAAAACATTTAGATTAGTAGTTCTCAACTGTGTCTGCACAGTA
TTTTCATCTGGTGAGCTTTGAAAAACTGCTGATGCCTAGAGCCCATCACCCCTTCTATCC
CAGCGATTCTGTTACAGTTGGTCAGGAGGGCAGCCTGAGCATCTGAATTTTTTTATTTTT
ATTTTTTATTCCCCACCCACCCTGATGGCTCAGTATGTTTGCTCATTGTTTTTGCTCATT
GTCTGCATGTTGTTTGTTTATTTTGTTTCTCCTTTAGGAGGAACTGGAAACCGAATATGG
GACCTCCAATGTGGGAGGTGGGCACCCATCTGCTTGAGCCACCACATCTGCTCCCTGCTC
ATATTTTTTTGTTTGTTTTTGTTCATTGTCAGCTCATTGTTTTCACTCCATGTCTGCTCG
TTGTTTGTTTGTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved