Dasypus_novemcinctus Locus Mono:267:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:267:SNORA70
Dasypus_novemcinctus
Mono:267:SNORA70
scaffold_147251
SNORA70
1001..1134
1573
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATATACTCAAATGTAAAGGTGAGTC
ATTCACTGTCTACCCATTCATTAACTAAAATCAGTTATCTCAAATAATGTTCGAGCCACT
ACTATATACTAAAACTGTAGTAAATTCTAGGAACACAGCAATGGAGCTTGTAGGCTAGTT
ATGGAAAGTTTTAAAAATAGAAATAGGAATTCGGACATTGTACCAGCCACTCAAATCCTT
TGTTTACAGGTAGGAAGGAAATTTACGGTAGTTAGAAGAATTATATGTGTTAACTTCAGG
GATGTTGTTTTTCTGAATCCTCATAAATTTCCCTCTTCAACCATCTCCTTCCTCCTGGTA
CATCTTTTCTCAGTTACCAAGGTGGATTCCTTTCCTGCTTGCCCATACCTATTTAACTTC
CTAGAGCCTTTGCCACTGTTGGCCAACATAGATCTGTCTTGCAACATCAGTGTTCCACTC
TCATTCCCAATTCTCAAAGCTAGTTATTGGGAAAAAAGTCTCTGATAAAATTAATTTATA
TTTAAAGTATTTATGACTTAATATGCTTAATATAATTAAATTATTTTTGAGTATAGCTCA
CATTTATTTAATGTTTGTAAAAGTTTCAGAGTCTATATATCAAAAGAAAATGACTCATGA
ATTCCCTTTTTTGTACTCAATAAAAGTTGATTGAATGGATTAAAATACAAACATTCCCAT
AAGTATCTGAGAAGTATTATGAAAGGTAGCTTACTGGAATGGAAATAAAATGAGATTTGG
AATCAACGATATATTTGAATATAGTTTTTACTTACTTTCTAGTGACCTTTGTTAAGGCAT
TTAACTTCTCTAAGCCACAGTTTCAGAATATTCGAAATGAGACGGAGTAACTCATTTCCA
ATGTCCACTTAATACAGCATAAGCATCATAACTAACATAGGCAAAATACCTTGAACATTG
CATAAGTTAGGCAGCTTTTAATTTAAAAGAACAGTAGTTCTCTGCAGTCAATTAAGCTGA
CCATCTTCCTTTCCGTGTGGGGACCAGTAAGCAATAACTGAAAACTGCAGCCTCCTTGGT
AGTGTCTAGACCCTATTTCTTATTTGGGTTTCTTTGAAGGACCTTGGAAACAGCCCTCAC
CTATTTATGTTCATGTATGACTTCACACCGTGCCCAATCTAGGGTCCAGATAGGTGTGCA
AGGTGCCTTTAGAAAGCCCAAGGGTCTGGTGGTCAAGGTCCACATCAGCCAAGTCATGCC
CATTCCACACCAAGCTTCAAAATAAGAAGGGTGTGATTGAGGTGCTACATGGGACTCCCT
GGTCATCAGATGATCTGTATCTCCAAGGCATGGAGTTTTACCATGTTTAATATTGGTGAA
TTTGAAATCATGGTATCTGAGAAGGACCATATCCCAGATGGTTATGGAGACAAATACATC
CCCAGTCGTGGCCCTTTGGACAAGTGTTGCACCCTGTACTCATGAGGACTGTGCCAGTAC
TAGTCTCACTTGACTTGTGTTCACTAATAAACTATTTCCTGACCATCAAATCAATAGTAA
CACAAACAAAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved