Dasypus_novemcinctus Locus Mono:158:SNORD52
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:158:SNORD52
Dasypus_novemcinctus
Mono:158:SNORD52
scaffold_62232
SNORD52
1001..1060
1852
CTGATGTGAAATAATCAGAATAAGCAAACTCCTTGAGTCATAATCTAGAATATAAGATT
TCCATGTGGTGGTGGGAGAATAGAGAATAGGGGAGTTAAGGCTTCACAAATACAGTTTCT
ATTTGAGATGATGGAAAAGTTTTGGTAATGGATGGTGGTGATCATAGCAAACTTTGTTAA
CATAATTAACAGAACTAAATTATATATTTGATTATGGGTAAAAGGGGAAATTTGAGGTTG
TATATGTGGCAGTAAGAAAATTACAAAAAGAAAATCCATGGAACTGCACAACATAAAGAG
TGAACCCTTAGACCACAGGCTATAGTTAATACTGCAAATATAAGCATGTGCTTTCATCAA
TTGTAACAAATGAACCTCATCAATGCAAGGTATTAAAAATAGGGTGGTAGTACATAGGAA
TCCTGCATTTTATACATAATTATAAAAAACTACATTGTTAATGGTTGCTTAATGAATGAA
AAAAATGAGTGAATAAAATAGGTAGGGTCAAAAAAAGCTAGAGGACCTTGCTTTAGTGGC
TGATGACACTGAAGAGAAGGCCAACACTGCATGCAATCACTGAGAAAATTACTGCAATTC
TCCAATAGACTTAGAAAGACAAGCTCATCCCTGAGGGGAATAACAATATAAATGCCAACA
TCTCCAAAACAAAAGATTCCACTACAATTTCTATTGTCAACACATTGTTTATCTCAAAAT
ACTCTTGTTGATATCTTGGCCTTAGGAATAATAATGGTATAAAATGTTCTCAAAGTGCAA
GCAAATGAGTATGAAAAATGATGATTTCACAGATGATAAACATAAATGCAGGCAGCGCTG
ACTATTTTAATTTAAAAAAAAGACTTTTCTTTTGAAATCAACCTTCTAGAAGATTGCTCA
GAAGATACTGTCATCGCTAGAAATGCAAGACAAAAAAATCACCAAGTAGCACCACTGTTT
CTGTAATAGATGAAAAAGGAGCAAGTGTAATGAAAGAACCCAACTAACTACACAGGGACT
GGGACCATTTTAAAAACTAATAGCAGACAAAGGCATTTCAAAGCAGATAAATGTAGCCTA
ATGATGGCTTTGATGAGCCTTTGTCTCTCAGTTCTTTGTGCACAGTAAAATAAGAAGAAT
TTTAAAAAGAGCAAAATAGTCAAAAACTTAGCTGTATGTGTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved