Dasypus_novemcinctus Locus Mono:291:SNORD30
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:291:SNORD30
Dasypus_novemcinctus
Mono:291:SNORD30
scaffold_184330
SNORD30
1001..1064
1384
CTTCTTTTTTTATTTATTTATAAGCTTTGCGACCTTCTGTAAGTTACTTAACCTTTTGG
GCTTTCGTTATTCACCTCACTGGGATATTATGAGGATTAAACAAGATAGAGTATATAACA
CAGCTGAGAGCCTGGTACATAAGATATAGTCAATCATTGTTCCCTTCTTTTCTCTCTCAG
TTTCTTCCCTCTTCCTCTCACCTCTTCCATTTTATCCACTAGGGATATTCCAAAAGATAC
AGAGGGACATTTACCAAAAGGAATTATATTATAAGTCAGAATTAATTTCCAGTTTCTGAG
AATAATGAAAATGTAGCTCATATTACCAAAGAAGTTTATAGAATCTCATTCTTCTGACTA
ATTAGAGACATACCATCTATCTATATACTTGGCATCTATCTATATTTTTAGCCTATCAGG
TATAGCCCTTCACAGGGTCAGAAAGACATTCCAGAAGCCCTGTGGAGAGGCTGATTTTTT
TTCTAGCTTTCTCTAGATTTAAGGATCAATACTGGGAAGCAGATGTGGCTCAAGCAATTG
AGCTCCCACCTATTTCATGGGAAATCCCATGTTTGGTTCCTGGTGCCTCCTAAAGAAGAG
AAGCAAGACAGCAAGCTGATGGGCTGGGCTGGCATGGCAAACTGACACAACAAAATGATG
CAACAAGAGACATAAGGAGGAAAATATAATGAGAGAGCTAAGCAGGGAGTGAAGGTGGTT
CAAGCAATTGGGTACCTCCCTCCTACATGCAGGTTCCCAGGTTTGGTTCCTGGTGCCTCC
TACAAGGAAGATGAGCACACAATCAACAGACACAGTGAGCACAAACAATGGGGGAAGAGG
GGGGAAAGATAAATAAATAAAATAAATCTTTTTTAAAAAAAAGGATCAATACTAAGTCAT
ATGGAAAAAGGGCTGTAGCAGTTTGATATAGTTATGAATTCCAAAAATAGATACTGGATT
ATGCTTTTAGTCTGATCTGTATCTGGGCAAGATTAAGTTATGATTAGGGCATGGCAAAGA
ACAGAGTTGAGGGTTTCTGATGCTGGAGTTTTGATGTTGGAGTTTGATGCTGAAGCTGGA
GCCCCAGGGAGAGAAACAGCCATTCGCCTGAAAGTCTACAGCTGACCTTGTGGAGAGAGA
GCCTCATAGTCTATAGCTGACCTTGCAGAGGAAACAGAGGAAACTGAGCCCAGAGGAACC
CAGAAAGCCTGAGCGCTCACAGACGTCAGCAGCCATCTTGCTCCAACATGTGGAAATAAG
ACTGTGGTGAGGGAAGTAACTTATGCTTTATGGCCTAGTAACTGTAAGCTCCTACCCTAA
ATAAATACCCTTTATAACGCCCAGCAGATTTCTGACATTTTGCATCAACACCCCTTTGGC
TGACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved