Dasypus_novemcinctus Locus Mono:27:SNORA70
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:27:SNORA70
Dasypus_novemcinctus
Mono:27:SNORA70
scaffold_10382
SNORA70
1001..1132
2132
GGAACGGGTGCCCTCTAAGTGCCAGCCCTTCTACACACGTCATGGGCGCGACCTCGTTT
CATTCTAACACGCGCCCACAGACAGGGCACTGTTACTTTCTCCACTCGAGAGACGGGGAA
GTTGAGGCGCAGAGCAGTGCCAGGATTTAACCATGAGCGGGGTCCCCCCGTCCCACCACC
TTAACCTCTCCTGATGATCAAGGTGCCACTCATGCCACCAGGGTGGAGAGAGAGCTGAAC
CCACAGCTTCCACCTTCTCCACCCCTGCCCCACCCAGGAGCCCCCAGACTCCCTGTGGCT
CTGCCTAACATGCTGGGAGACCTGGTCAGGGGCACGGAGTGGACCTGGGCTCAGTAGGAT
GGAGGAGGGAGGGACGGAGGAGCCGCCCACCCTTGGTAGAGTGTCCCCCTCTCAGGCGTC
TCCACCCCCCTCCATGCCTCACCCCTATCCCAGCCCCATCTGCTCCCTCTGCTTTCCTTT
CTGCCCCTTTCTTCCCCCTCCCTAGAAGGATTTATGGTTTTAATAATGCAGACAATCTCT
ACCAGCCTCCCTGGCTGTTTAGTCCCCTCTAAAGATCCTTAAAATTAAAACACTAATCAG
AAATTTATTTTCCCATCAATCCTGCCCTTTGGGTTATGAGGCTCGAGTGCTTTCACAGCT
GGCCTGCCAGGGAGGGGCCCTGGAAACAGGGGAGGGGAGAGAAGTGGAGGGAGAGGGAGA
CAGCAAGAGACGGCAAGAGACCATCAGGCTGGGGCCAGAGAGAAAGGGAGAGAGACAGAG
CAGCAGTGCGTGAGCACAGAGAGCTGGACGGGCTGCGGGCGTCTGGGAAGGGGCGAGGAC
GGAGCAGAGGCTGAGGCTGAGAGAAGCAGAGTGGGCCAGAGATGGAACGGGGGGATGGAG
CCAGGAGAGAGAGAGGCAGCGTGAGGAAGAGACGGAAGGGGGGGAAGTGCGGGCGAGTGG
GGACCACCAAAGGCAGATGAGAAATCAAAGACAGCAAAAGGCTGCAGCCAATTAAGCCGA
TGGTCTCCCTCCCCGTGGGGCCTGGTGTGCAGTGGCTCGGAGAGCAGCCTCCTTGGTGGT
GTACGTGGCTTGTTGCCTTGTACGGGCTGCCCTAAGGGACCGTGGAGACAGCCCTTGCCT
ATTGCGGGTCCTGTCTGTGACCTCGTGCCATCCCTAATCCAGGCTCCAGATGGGTATGCA
GGGTGCCTTTGGAAAGGCTCAGGGAACCGTGGCCCGGTCCACATCGGCCAGGTCATCGTG
TCCATCTGCACCAAGCTTCAGAACAAGGAGCCTGTGACTGAGGCACCACGCAGGGCCAAG
TTCAAGTTCCCTGGCCATGAGAAAATACCCATCTCCAAGAAGTGGGGCTCACCAAGTTCA
ATGCTGATGAATTCAAAGACTCGGAGGCTGAGAAGCGCCTCATCCCGGATGCCTGAGGGG
TGAAATCCATCCCCAGTCATGGCCCCTTGGTGGTGGGCCCTGCACTCCTGAGGGCTTTGC
CAGCACTGCCCTCGCCCGACTGGTGCCCTCCAGTAAATGACTTCCTGGCAGTCTAAAAAG
AAAGCAAACGGGACCGGGGGACACAGAGGAGGGGCTGGCTGAGACAACGGGGGGGCACAG
ACCAGCTGGGCGGGGGGGAACCTTCCTCTCCTCCCCCTGACGTGCTCTCCTACAAATGCA
CGTTTTGGGAGCGATCCTGTGGCAGGTCTGTCTGCCCCTACCAGAGGGCAAGCTCCAGGA
GAGCAGGGCCGGTAGTTTCCCCCTTTGTTCTGCGGTAATGAACCAGGCAGGGTACTTTGC
TGCTCCTTCCAGCTTTCAGGTCACTACATACTGCGCAGTGAAGCCTTTGGGCAGGCCTCC
CCTTCCCCTGGAGCCAGCCACTGCCCTCTCCTTTCTGTACAGGGAGCTCCTGACAAGGTC
TCACCTCTTTCCACAAGCCCCCTGCCTGCTCAAAGTGGCTGTTTGCAAAGCATGTTTCTC
CTGACCCAGCATCACTGCTCCCCATCTGGGGAAACTTTTGAGACCAATCCGGTCACCTCC
CTCTTTGCCTCTGACTGGCTATGTAATTGTGAATGAGCCACTGGCCTTCTCTGAGCCTCT
GTCTCCTCCTCTTAAAATGAGGGGTTCAGATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved