Dasypus_novemcinctus Locus Mono:167:SNORD116
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:167:SNORD116
Dasypus_novemcinctus
Mono:167:SNORD116
scaffold_68074
SNORD116
1001..1094
2094
TTATTTGTCTTCCCTTCTGCTGCCATCCACCCCCCCCCCCGCCGTTGTCTGCTCTCTTG
TGTCCATTCACTGTGTGTTCTTCTGTGTCCACTTGCATTCTTGGTGGCATTGGGTATCTG
TGTCCTTTTCTTTGTTGTTGTGTCATCTTGCTGTGTCATTCAGCTTTCTGTGTGTGCAGT
ATCACTCCTGGGTGGGCTGCACTTTTCACGCAGGGTGGTTCTCCTTGCGGGGCGCAAACC
ATGCATGTGGGGCTCCCCTATGTGGGGGACACCTCTGCATGGCATAGTACTCCTTGAGCG
CGGCAGCGCTGCGCATGGGCCAGCTCATCACACAGGCCAGGAGGCCCTGGATTTCAACGC
TGGACCTCCTATAAGGTGGGCGGATGCTCTATCAGTTGAGCCACATCTGCTTCCCGGAGA
CACTACTTTAAACACTCATATTTCACAGTGGTCCCACAGAGCAAACATGCATGCATCCAT
GTCACCATACATGTGAAGTTATATAATACAACCAAAATGATACATAGGCATGGTATGTAA
GGCAGAGGAAAATGCATGTTGTACTGTTTGCCTTTGTTCATTTCCTTGTTGCCCAATCAT
GCACTTGTTTCCTGCTGACATCAGGTGGAGATGCCATCAAACGGAAGCCATTCAGGTGGA
AGGAGTGTATGTTCACTTTAACATTCGGATGTGCATTAAATTTTCTGGAAGCAGTGTGGC
CCTGAGTCCTCTGGAATTCGGTAGGTGACTCATGGAAGCAAGAATATTCTTGGGGGGTAG
CTAAATGTACCGCTAGTCTCCTATGGAATATATAGACCTAAAAGGAATTCCTTTTGTTAT
ATCAAAACACCATTCCCAGACCCACTCCTTGAGTATCTGGCCTCTTTTTCCATAATCAGT
GGTTTGCTTTCGGATAGTCTAGAAATCGACACTATCTGCACCCATGACCCCTACATACTC
CAGCCTGCAGCTTAAAATTTCTAGACTGTAACAATGTGCTTGGATCGATGATGGCACCCT
AATCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAAATCCCTACCATCTCCTCTC
ATTGAACTGAGGTCCAGCCCATTGTCTCTTTCTAAGTTACTACTTGAGTGAGGGGCACAC
AGGTACCACGGGTTGTCTGCTGTCCTCTGGCCCAGGCCTTTCCACTGTGCGTGTAAATGG
TCTTCTGGGCACCAGAGAGATTCAGTTTAGCACATAGCACTTGTGACCATATCCCTTCCT
GCTTGGATCCCCTCTGAGGTCTGTCTTCCAGTCAGTACTCATGCTCACTGAACTGGCTGA
TAGGGATTTATTGAGGGAATTTATAACACCAGAGCTTGAGTCTGTATAGGCCTTTGAGAC
CTTCAGGTAGTCCACGCTACCCACTTCTGGAGGATGGAGTCCAGGTTTTTGAGTCACTGA
ATGTGCCTTAGGTCCAGGATTTAGCAGTGATTTCCCAGTTTATGTTATTTGGTGAGGAAT
TGGAGTGCCAGTGGTGTTTGGGTTGAGTTAATCAAGGGAATTCTTGATAGGCATGCTGAC
AACTCATCTAGAGCATTGCAGGAATCCAGCCACCAGTGGCCATTGCTGGTTACTGTACAC
TTGACCTCAAAATGATATTATGGTGCTTTGGGCCTTGCTGGCCAGCTAAGGTAGGAAACA
GGGACAGTTACTGGTGAAAGGATCAGTTGTCTTTGAAGTCGTTTAATGGCTGCATTTTCT
TCATGTTGCCATTGGTGTTCTACATAATTCATTTGGTAAAGGTGGTATATGGAGGTGGTC
CTATAATGGGATGTTTAAAGTTCTCGTGGATAGGAATTTGGGTATATGGCCTTGGTTCAC
ATAGGATGTATATTCCACAGTAGTAGGTACCAGCCTTCTCTTCATAGCATCATAGTTATG
TACTGGGCTTACAAAGCAGTTGCCAATAATTTAGCAAGCTAGGCTGAAAGCATTCCTGAC
TCTTGCCACTTCCCTGTTCATGCTAAGTTTCACATTCAAGAGTTGTGTTTCTTTTTCCTG
AAAGGCCCCAACTCGCATCTGTGTCTCCCTCATGCCTTCTGCTGAAAGTTTGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved