Dasypus_novemcinctus Locus Poly:7:SNORD116
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:7:SNORD116
Dasypus_novemcinctus
Poly:7:SNORD116
scaffold_43590
SNORD116, SNORD116
1001..1091, 4370..4463
5463
AAAAAATGTCAAAATCCAGGAATTTCCCTATTTTGGTAAGAGATATAGCATGCCCCATT
CTGCATACATATTTACCATTTGAAATTGAGTTCTCTGTTTCTTAGTTAATTCATGTTTTG
TTGTTTGAGATTCTGGTATTCCCCATCCTTTGCTTGAGATTTGATTTTCTCCTGGTCGTT
GTTTTCTGAGCTACTTTATTTGTTTCTATTTGTGGCCAAAGTCATTACTAAAGTGTTGAA
TTCTAATTTACTTGCAGGAAGAATGTCCATTAACTATTGGTTCACCCTATGTACAGCAGT
GGTGGAAAGCACGGGATATGTGATATCTTTCTACATCCAAAGTAGACCAAAGTAGGCAGA
TTGAGAGTTGGGGCATCAAATTCCTGAAGCATGGTACCAGCTTTGGTACCCAATAATTGC
ACACCAGGAATGTTTTCTGCTAGTGAAGAACCTTCAGTATAACCTGTTTGTATGCCCAAG
TGCAGCAGGTCCAAGGGTATATCTTAGTATCCACACACGTGCATAGTTGGTGGAGGTAAA
TGAAATGTACATGCATGAGGGGAAATAGATTTTCTGTTTACCCTGGTCCTCATCCTCCTG
AGTAGTCATGTTTGCATTTGTTTCCTGTACACTTCTTAGGTGGAATTAACATGAATGGAT
TCCATGTGAAGGGAAGGCAAATAACCCTGTGTTTACTACCCTCAGATTTAAGGGAATCCC
TGGAAGATCTGTGGCCAGGAGTCTGGAGAATTTTGGACATCGCTCTCTGTGGTATGCATT
TTATTTTCCCATGCTACTGGTAGTCTCCCAAAATTAGGTCCATCTCCAGGGACCTCTTAC
CTTCCATTCACAAATGGCGTGCTGAGTTTCAATCCTTGAGTGTCATTGGTTTTCTCTGTG
ATCAATGGCCTGGCACTGATAATGCCATCTGAATAAATGTTTAAAGCCATCTGCTGTCCA
AATGCCATACCTGGAGTCTTAAAATTGGGCATTTTTTGCCTGCATCAATGATGACACTCT
GAATGCATTCCTTGGAACCTGAACAAAATGAGTGAGAACTCTATACCGTCTCATCTCATC
AGGCTGAGGTCCAGCACGTTGCCTCTTTCCTACACATCTGTGAGGGAGGGGCAGTTTCCA
TGTGTTTCCGTTCATGCTCCCACTCAGAGCTTGAACCATCCATGTCTCCAGCCCTCAGTC
ACTAGAAAGATGCGTTTTTTCCCCGACTTGAATACTGGGGTCCCTTGGGATGGGAGCTTT
CTGACAGCTCGGCTCCCCACACGCATGCAGCATCTGTGCATTGGTGGGTGTAAAGCTGGA
AGCTGCCTTGTGACATCGCAGTACAGAAGGTACAGTCTGTTGAACTCTAGGAAAAAGAAA
GCAGGTCCAAAGTGTCAATTAGAGTGTCAGTAAGGCCATATGTCAGGCATTCTTAACCAG
GGGTCCATCCGCTTAAATTGAAATTAAAAAACATTATTCTTGTGGTTTTGATATATTTAT
TAAATAATACACAGTATAGTGGGACTTAGTACGGGGTCCATGGATTTCATCTGAATGTCA
GATTGGTCCATGGAACAAAAAAGATTAAGAGCCCCTTCCATGGAGTGCAGAATATTTTCT
CATTTTGTTTTTATAATTTCGTGAAGAAATATGAGTGCCCACCAACATGGGAGTAGAGTT
ATGGATGGTTAAAAACCTCTTTTTTTTTTAAATTTTTAAATTTTTCTCTCTTTATTTTTT
TACATGTTACATTCAAAAAACGAGGTCCCCATATACCTCCCACCCCCGTCACCCCACTCC
TCCCACATCAACAACCTCTTTGATCATCGTGGGACAGTCATTGAATTTGGCGAATACATT
TTGGAGTGCTGCTGCACCACATGGATAATGGTTTACATTGTAGTTTACACTCCCCCCAGT
CCCTCTTTGATGTCTTCCTGAATATATTGGGATGTTTCATAGCATTTTTTTAAAGGATTA
AAAAAAAATTTCTCCCCTTCCCCCTGTTGTCTGTTCTCTGTGTCCATTCGCTGTGAGTTC
TTCTGTGTCCACTGGCATTCTTGTCATGTGGCACTGGGAAACTGTGTCACTTTTTTTGTT
GTTGGTTTTCCTGCATCATCTTGCTGCATCAGCTCTCCATGTGTGTGGTGCCACTCCTGG
GCAGGTTGCACTTTTTTCACGTGGGGCAGCTCTCCTTGCCAGATGCACTCCTTGTGCATG
AGGCACCCCTACAAGGGGGACACCCGTGTGTGGCATGGCACTCCTTGTGCATGGCAGCCC
TGCACGTGGGTCAGCTCACCACATGGGTCAGGAGACCCTGGGCATCGAACCCTGGACCCT
CCATGTGGTAGGCGGATGCTGTATCAGTTGAGCCATAACTACTTCCCTGTTTCATACCAT
TTTGCTTAAGTATTGACATTGCAGGGAAATCAGTCTTCTATGGGGCTTGTGGAGTAAATA
AGAAGCCAGGGAAGAGTGCTCGTGAAATGGTGTTTGTCACCATGAGTTTATCAACAGATA
GACTTTCTGTAGATATTGTAGTATTTGCATGCTGTCTGTGGTTTATATCATCATGCCTGA
CTTTGTATGGAATGGAATGTTCTAACATCTATGTTTACAAGCACTTGAGGGAATTTTTTC
CTGTTCTCCCAGCATATATTCCAGAGAACTAAACATGACATTTTCCTTTTTTGGTCTGTA
GTGAACCATTGGCCCTCCAATTGCAATAGGTCAGTTAAGTAGATGCTCTAATCTAAAAGT
ATGGTGCATCTCGAGCACCTGTCCATAGTAGGTTTCCTAAGGGAAGGTGTTTTTTGTTTT
TTTTTTAAGTAAAGGCCCATTTGACATGCTTCACTATGTCAAATGCATGTCAAGAAAATG
TTTGCTTCTTCTATGCAACTTTGTTGCTCACCTGTCTGGGTACAGTAACCACAGTTCCTC
CAAAGAAATCTGGAATTTAAATTCATCTAAGAATAAGCGTTCTAGTTGCCTCATTTTTAT
TTTGTTGGTATCTTATCATTGTTGATTTTGTTCACATATTATTCACATGGCATAGGGCCC
AAATAGTGACTTCCCAAGTGATGAATGAGAAGTTGTTTTTGTTAGTATTTTCAGCAGACA
TGCCCTTTTTTGTTGTTATACATGTAGATTTTTCTATGCAAGAATGTACAAGAGAGTGAT
TAATGTTTGTTGCCTGAGTTTACTTTTGCACTGATATCAGGATAGTGAGGCTCATAATTG
TGAAGATACCAAGTACTTGTGAATTGCCCGTTTTTCAGTAATACCTTTTATCATGAACCA
CTCATACAATTTTCCCCTGTTGTATCCTTATGGCTGTTGGCCCTGTGAGGAGGTGTTGAC
TGGATTGTTGAGAAACAGTGCATGTCTGGGACCAGGTGTCAGTTCTCAGATGGACTGCTC
TGCTCCTTGGCCAAATATCATGGCTGTGTGTCTATTGATCCCTTCACTCAACATCTGGTC
TTTGAGACACATCCTCTCTTGTCAATACACCATTCCTTCTTATAGTTGAGCAATAGTCCA
TCATTTGTATATGGCACATTTTGTTTATCCACCCATCTGTTGGCAAACACTTGGGTTGCT
CCCATTTTTGACAATTGTGAATAATGCTGCGATGAACATTGGTGTGCATATATCTGTTTG
CGTCCCTGTTTTCAACTAGAAGGCACTCATTTATTAGAAGTTACCTGAATACAGAGATAG
AGGTGTGTATTGTACAATTGAAAAAAGACTTTTTTCAAAAGAGGAAGCATTTAAACGTAT
ACTTTCCAAATGGCCCCACACATCAAACATGCAAACATACATACCCCTATCCCATCTTAT
ATACCTATATTTATAATGTATCCATAAAGAGAAACATAAGTGATTTTTAAGTATGGTATG
TGAGGCAGTGGGAAAGTTATTAAACTGTTTGCCTCTGATCTTTTGGTCTTTTCTCAATTG
TGCATTTGTTTCCTGCTTACTTTTCAGGTGGAGGTGCCATGAATGGAAGCTGTTTGGGTA
GAAAGAGTCTACATTTCTTTTGCAACTGTAGGTTCAGGAAAGTTCCTGGCAGGAGTATGG
CCCCGAGTCTCCCAGAATCTGATAGGAGGCCCCTGACAGTAAGGTTTTATTCTGACTAAA
TGAACCACTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAC
CCCTACACATCCCCAGCCTGATGCTAAAACTTCTAGACTGTAACATGCTTGGATTGATGA
TGACACCCTAATCAGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAAATCCCTACTG
TCTCCTCTCATCGAACTGAGGTCCAGTACGTTGTCTCTTTCTAAGTTAATATGTGAGCGA
GGGGCACACATGTTCCATGGGTTGTCTGCTGTCCTCTGTCACAGGCCTTTTCACTGTGGG
TGTCTGTTGTCTTCCTGGCATTATAGAGTCTCAATTTTACACATAATTGTAGGGAACTTA
TCCCTTGCCGCTTTGATCCTCTATGAGATCCATCTTATGAGTCAATATTCAACTCATTGA
GTTGGGTGCTGGAGTTTTACACACCATGTCTGTAGTCTGACCACATATTTTGAAACCTTC
ATGTAGTCTTCTGCTACCCATATCTAGAGGATGGAGACTGGTTTTTGAGTCACTGAGTAC
TTCCTTAGGTGAAAGATTTATCAGTGATTTCTGAGTTTATGTATTTAGTAAGTAATTGGA
GTGCCAGTGGTATTTGTGTTGTTAATGGATCATTGATGGGGATGCTGTCAAGCCATTTAT
AAACATTGCTAGGATTCAGAGTAAACGAGTTATTCCTTGTTACTTTACTCTTGACCTCAA
AATAATATGGAGGTGCTACAGGCATTTCTGGCCACATGAAATTGGAAGCAGTGACAGTTG
CTCCTGAAATGATTAGATGTCTTTGGAAGTTTTTTAATGGCTAAAGTATCCTCGTGTTGC
CATAGGTGTTCTATGTAATTCATCTGGTAAAAGAAATGTATAAAGGTCATCCTGTAATGG
AATGTTCTGATTTTATTCATATGGGAATTTGGTTATATGGCCTTGGTTTACAATAGTAAG
CACCATCCTTCTTTTTACAGATCATCAAAGTTATCTTACATAGCCAGTTGCTAGTATTTT
AGCAAGCTTAGGCTAAAAGTCTTTACTGAATCCTGCTACTCCCTGGCCATGCTTGGGTTC
ACATCCAAGGTTTCACTTTTTTTTTTTAAGAGACCCCCATATAATTTATTGCATTTTACC
TTCTCATGCACTGTTAGAAATTTGATTTATCCATTTACATAGGTTTCTTTCTTTCTTTTT
TTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved