Dasypus_novemcinctus Locus Mono:403:SNORA24
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:403:SNORA24
Dasypus_novemcinctus
Mono:403:SNORA24
GeneScaffold_3068
SNORA24
1001..1121
2121
CTGGGTTTGGTTCCCAGTGCCTCTTAAAAGGTAGACAAGCACACTATGAACAGACAATA
TAGAGCAGACAGTGAGTGCAAACAATGTGGGGGGGGGGGGGCGGGGCAGGGGGAGAGATA
AATAAATAAAAATCTTTAAAAAATTGCTCTTGGGAAGAAAAAAAAAAGTATAGGACAGGA
TACCAGTAGCAACATGGGGGTGAGGAGGAATTGGGAGTTGATGCATAATGGGTACAGGGC
TTCTGTTTGGGTTGATGGGAAAGTTCTAGTAATGGATGGTGGTGAGAGCAGCATAACATT
GTGAATGTGAATAATTCCACGGAACTGTATGTTTGGGAGCAGTTGAGATGGGAAAGTTCA
TGTTGTATATATGTTTCCACAATTAAAAAAAGAGAGCCTAAAGAACCAATAACAACTATA
CACGATACATGACGCTGGACTGAATATACTAATAGAGAAGAAAATGCCCAAAATGACATT
AAGACACATATATATATAAAAATTGGTACAGAGAATGAAAGTTTTATGTCACTGTTAGTT
TTTGAACTTGACAACTATACTTTAGGTGGTTGCATACATGAATGTCCTTGTTCTCAAGAA
AAGTGCATGGAAGTATTAAGCATTCAAAGAAAATGTGTTCAACCTATTCTCAAAATATTT
AGAAAATTATAGTTAAATAGACACGTAGATATGGATAGACAGAATGATACAGCAAATGTG
GCAAAACGTTAAAAGATGGCAGATTGTGTATCTGGATGGGTGCTCATTTGGAGTTTTTTT
AAAAATTATTATTGTTGCAACTGTCCCAGATATTTGAAATTATTTCAAAATAAAGCATTA
CACATTAAAAAAAAAAAAAGAAGAAGAAGAAAAGAAGAACTGTACAAGGCAAAGAGTGAA
CCCAAATGCACACTATGGACTTCACCCAAAAATATAATTCTAATAATATTAGTTCATCAA
TTGTGTCACATACTGCACTAATGCAAAATGTTAATAAATAGGGAAGCTTTGGGACCTGTC
ATCTGTGGCAGTCTCCCTCCCTAGCCATGGAAGAGCATTTTCTTGTTTACTGGCAAAGCT
GTTGTTGTGGAATTTAAGAGAAGTTTAATTATTTGAGTATAGAGAGGCCAGGACTCAGTA
ATGATTTTGAGAAGGAAAAATGGTTTATTGACGGCCGGCTGGACTCGGGAGCTTTCAGTT
TGAATCTCCAGCTCCGAACAAGATTTTTAAACGTTTTTTATACAGAGAGGAAAGGCCAAA
TGGTCTCTTTGTTTCAGTTTTCAATAGGCTTTAATTAGCACATATCTTTTACATCTTAGG
TAAGCTTTTAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGG
TGATCATTTAGGATGATTATAAGGTGGAAAAGTAAAAAATGAACAGACTTGTTTATTCTG
GCATGGTGGAAAGGTGTAACTTTACTTACAAAAGTGTGTGTTGAACACTTAAGAGTTAAA
ACAAAATTTGCTACAATGAAGGCATTATTTCATGAACCATGTGTTCCAGTTAGGATTCAG
CAAAAGTTCAGGCCATCCATTTTCAAAAGTTATCTTGGAACAACCATGCCCATTCCTTTA
CATATTGTTAAGGTTTGTTTTCTGAAATGGTGATTATCCTTAACAAGTTTGCTGACCCCT
GGTTTATGTGTTACTTGAACCTGTGCTGGAACTTACTGAAGGCAACCTCAATAAAGAATG
CATTTTCTCGTTAAAAAATAAATAAATAGGAAAGCTTTCTGTGTGGAATATCAGTGTTAC
AGGGGAACTCTGTACTTTTCACATAAATTTTCTTTAAACCTGCAAATGCTCTAAAATATA
GCTTATTAAAGCATTTTTTAAAAATAGTAGATCCTGCTAAGCTTCCAAAGTGAATTAATA
TATAGCTTTTATGGTTAGGCTTATCATTTGTAAAATGAGGAAAGCTAGTATTTTACTACT
TGACTTGCTTACTGTGATGGTTAGGCTATTGTGCCAACTCCACCAGGTAATTGTGCTCAG
TTATTTGGTCAACCAAGCACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved