Dasypus_novemcinctus Locus Mono:252:SNORA24
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:252:SNORA24
Dasypus_novemcinctus
Mono:252:SNORA24
scaffold_132661
SNORA24
1001..1131
1281
ACTGTGAGTTGCTTTGAACGAATCTGGTTTCTAAGATTTTGAGTCTTAGTTCCTCGTTT
TTGACATTGTCCATAAGCTCTCCAGAAATAAAAGCTGGCAAAGAGGAACGGAAGGCAAAA
TACTAGGAGAGGGTAGAGCTTACCAAACATAGACATGAACTGTTCGGCCATAGCTGGTAC
ATCCAAAATGCACATTTCCACACCTGCATGATGCCTGGTGGTGCTAAAGAACCATTCTGG
CAGAGGTAACAGGCTAGCTACAGCCCAGATTGCTGCCAGCACTGACCAGATGGTGCAGTT
ATGGATACTTACTTGCTTGGCTGGATCACTTGCATACATGAAGCATACTTTGGCCACTGC
AACAATTGTCAGACTCTTGGCTGCCATGCACATGTGAATGAACCAGTCAGAACACTTGCA
GACAAACCAGCCTAGATCCCAAATACCTTTGGAATATGCTGTAGCCCGGACAGGTGCAGA
AAAAAGCAGAAGAGAGAGATCAGTCAGGCTGAGATTCAGAATCAGGGAATGGATCATGGA
TGGCTTTCCTTTCCAAGCGCTGTGAAGGAGGATGCCAACCACACACAGGTTCCCCACGAA
GCCCACCAGGCAGACAGCCACCAAGAGAGCTGGGACTATGGTCCTCCAGTCCTTGGAATC
AGAGGGCAGGTACCCTCCGGCAAAGTGGAGGTGGGCAAAGGACACGTTCATGGTGCTGGG
GTTGGAGTCTGCGAAGGCAGCTGCCAGCATTGGCGTTTCCACACACTCTTTAATGGAGTT
AGCTTATTTAGGCTTGCCTTTCTGCGTAGGAAATAAGTACTCTGTCGTCAGTGTCAAATG
ACATCTCTGGGCCCTCCCCTTCCTTATTTCCTGAAAGCAGAATATGGAAGAAGGTTGACT
GCTAAGCTCGTCTCTGCTGCATGTGATAAATTTATGATTGCACTGAAGGACAGGCAGCAG
GGGCCCACGGTAACTGCTCATTAGCAAGTCTAATGTCAGCCCTCTGTGTATCCTTGGGTC
CTGTCAGCTATGGCATTCTCCCTTCCTAACCATGGAAGAACATACTCTTGTTTATTGGCA
AAGCTGTCACCATTTAATTGGTATCAGATTTTGACTTGCACAAGTAACATTCCTCTGTTA
AAAACCTGGAATGTGCTGAGTTGTTGGGTAAACTTTGCTAACTTTTTCAAATGCTTCTAG
GAAGCTATACTAATGCTTCTGATGGATGCTGGGCAACATAAGATGTCAAGAAATCCAAAG
CGATAAAGGTGAAGTCTTGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved