Dasypus_novemcinctus Locus Mono:37:SNORD113
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:37:SNORD113
Dasypus_novemcinctus
Mono:37:SNORD113
scaffold_12458
SNORD113
1001..1070
2070
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTTCTTCTTGTTTTTTTGTAGTCATGCATTTTTGTGAAAAT
CAAATGAATTATAAATAAATAAAGATGAAGAGATTAAACATTGTAAAGTTATGCAAGTAT
GCATGGATACAAGAAATAGCTTTTTAGATGAAGGGATGGATAGATATAAAACATTGCATT
TCAAAGGACTTGGGTATTACATCTTGGCTAAGAATGATGGATACAATATAAGTAATTATC
AGTGATCTTGTTCTGTTCAGGGGGCAAGTTTGAGGTTGTTTTTCTTCCTACAGGGAATGA
AATAAATATTACTCAGTTCATTAATACCCATGTGACTGCTTAGTGCATGGTGAATGTAAC
GAACTAGGGAGACAATGTCTTAAGATGTTCATTATTTCCTCTGCTTTGTACTCTATAGAA
TGGACTCCCTTGAGCTGATACAGGCATTCTGTCATGCTCACACGCTCTAAGGTTGCCCAA
TGTGAGTAACAGTCAAGTTCTCGTCTTAGTTTGGGGTGGTTTGTTTGAGGGCCTTTGCTG
TATCACTAAGTCTAAGGTATAATCCAAGGGAGCCAGTGTGACCGAGTGGTTACTACAGAG
TTGATGTGAAGTATTATGCTGACTAATCCAAATGTGCAGCACTGACTCTATTAAAGAAAG
GACTCTAGTGTCATTGGGAAGTGGGTCGATAGACAGATGTTAGAGATATCCAGGTAGCTA
TGCTATGTTTTTGCCTCTCAAGTATTTGTATGTTATTATTTTTAGTGCACTGGTGAATTA
ATGCAATCATGTAGCTAGGAAGGAAGGAAGAGGGCCAGTCATGGGTGGATGATGACCACC
GGTGGCGTCTGAGTCAGGGATGGCGACTGTGTCTGGAACACGGAGGCCCACAAAGAAGGT
GCTCTAGCCTGTGCCTGTGGTTGAATACGATGCCACAGACAGACTTCAGGCATCTACGAG
GAGCTTATACTTTGCTTGTTTTTTAACTTAACGATGTCCTCAAAAAAGTAGCAGTAATTA
TTAATTTTATTAAGCCTGATTTTTAGTGCTTTTGTAACCAAACATGGAAAAAGCACTTGT
GCTGCGTATAGGATGTCCCCAGGAGAAAACAAAACAAAACAAACGAAAGAATTTCTCATT
TGTCAGTTGAACTAGCTGATGGTTTTTCATGGAACACCATATTCTGTTGAAAATTCTTCT
TTTACTTTGGGTCTATGGACTTTGGGTTCTAATACTATAAAATAATCCACGACAATATAT
GATCAATTATATTAGTAAGGAAGAAAAATTGAAGAATTTCCTAACAGTGAACATTTTTGG
TATATAAGTTACTCTAGTAACATAAATTTTTGGTGCCCATTAAAAAAAATCAGTGAATCT
AATGTGTTACCCCTTTGGCTAAGGAACACATAGACATGGATATGTAATGCCAACTTCATT
GCTCTGTGGTGATATATGAATATTAGGAAAATTTATAAATACCTAACTGCCAAGGAAATT
GAATGAGGACAGCAAGGATCCAAGGAAAGAAGGTCTCAATCTTTTTATCCTCTGTTCTGC
TTTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved