Dasypus_novemcinctus Locus Mono:245:SNORD64
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:245:SNORD64
Dasypus_novemcinctus
Mono:245:SNORD64
scaffold_126567
SNORD64
1001..1068
1302
GTCTAGGTCCTGAATTGAATTAAAATCACTTCTTTTGTGAAAGAGCAAGTTCTTAATAT
TATGTCTGTTTTTGATTTTTGGTTTTGGTGACATTTGAGTATTTCAGTTTAGATTGATTG
GATGATTTTGGAAATAAGGTATCACATTACATATAGTTCAAAACATCTAAGATCTCAATA
TTATTCTTCTGGCAGACTGTTTTGTTTTGTGCTAGTATTCTGAAAGACCTTGGCTGGATT
TATGATGAGATATGTTTACTGAGCCTGATGAAAAGAAAGCTCACTGTGATTACTCTGAAG
TCCAGCCTAAGTGTCAGTCCAGGGTCTCAGAACAAACCTCTGTCTGAAGGTCAGTTTATT
AGACTGGATTTCACAAGTTTTCCCCCTACGTATTGAGCAGAGTAGCAAGAATGTAAGTTT
CTTCAGTACCGTAGAGAAAGTTAGTTTTAAGTCCACTAGTACAGTTTACTTTTGTATAGG
GTATCTTCCTTGTTTGTTGCTTTCGTACATCTCATCTTTGTCTTTTCCACTAGGAATTTT
AAGTGATAACTTCAAGAGAATAAGGATTTGGGAAATGTTATACCTTTTTTTCCTATTACC
AGTATTACCCAGTTTCATCTTGAATCCAAGTTTCCTGAGGACAAGTCCCTGACCTATGGG
GAAGCTTCTTCATTTATCCATGTGAAAATAAAATTGTTAGCTTTTTTGTGAGACATTGTT
GTGGTATAACATGTGATCGTACTCTAATTATTCTCTTAAGTTACCATTTTCTGTATCTTG
ACAAGACATAGATGGTGAGTTAGAGGTTCTGACTCTGATTTAGTTAAGGGATGAAATTGA
GTTCTGTGGCTGTTGGTGTTGAGACCGAGAGATGAAATGCTCTGTAAATGTCATGCAGTT
CTTCAGTGAGGATTATGATAACTGGGAAAAGTCTTATTTCACAGTGTCCTATGATAATTG
ATCTCTGCTCGTGTAAATGATAGGTTATTAGCATTCTCTGGTTAGGTTCTTGTACTTACA
GTACTTACTATGAGGGAAATAGTGATTAAACCGTTAAGGAAAAACTTGTATTACAAAGGT
ACCATAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved