Dasypus_novemcinctus Locus Poly:22:SNORD81
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Poly:22:SNORD81
Dasypus_novemcinctus
Poly:22:SNORD81
GeneScaffold_2356
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1080, 1420..1481, 1660..1741, 2028..2093, 2393..2453, 2655..2719, 2891..2964, 3897..3972, 4117..4193
5193
GTGACTGTGTCCAAGCAGTAGGCGTAGGCAGGCAGGAGCCGCCGGGAGGTGGATGTGTA
TCTGGGTGTGTCCCGGCTGCAGTGGGGGAGGGGGCTGCCCATCCCGGGGTCCTGAGGGAG
GGGCCCCGCGAGGGGGCGGGTCCGGCAACTCAGCCCGGCCCGGGGCCAAGGGGGTGGAAG
GTCACCCGATGTCTTGGGTGGGTCGAGGGAAGTGGCTGCGCGCCCCAGCGACGGGCTACG
GTGGAGACGCGACGAGCTGGCCCTCGTGCAGGGCAATGGGACCAGGGTGCGGGGCCCGAG
TCCAATCGAGGAGCAGCACCTACCTCCGGGGGTGGAAATGGGCCGGAATGGGTCGGAACA
CCGTCCGGGAAAGTGAAACTTCTCACCTCTACCTCTGGAGCGGGCGACGTGCCGGAAGGA
AATCACTCACCCTTACACCGCCCCCCTTCCCCCTCTCTCAGCGCTTTCCGTCCCTCGCGC
CCCCTCCCCTCTCTTTTCTTCCTCCCTAGTAGCGAAGAGGGCGGGAACCCAGCGTCTCGC
GGGCAATCTTGGTCCCCTCCCATTACGGCCAAGCGGGGGCGGGCCCAAGGGGGCGTTCCT
AGGGGGCGGGGAAGTAGGAGGGGTTGAAAGAGGAGGCGGAGATGGAGAACGTGGACTGGA
AGAAGCCGATGCGAACGCCGGCGTAGAGTGCGTCGTAACGTCATGGAAAAGGGCCTTTAT
ATACAGACGTCCGGACGCCATATCGGTCTTTCAAGGCTGGGAGTGTCGTTCGAAAAGGTG
AGCGGTTGTTCGGTTGCTCTTTATTGAGCTTTTGGTGCAGGGCGTCCGATCTTAAAAATT
TAAGGTCTTATTGAGTCACCTGGTATTTTTAGGCCAGCCACGGTCTTTGCAGGGCTCCCA
AAATGCGGATGGTGCCGGATTGTGCTTTGGGTGCCATGGTGCAACTTAATCTCCGCGATG
CGGATATTTGGGACCGAACCTGCGGAGAGCTCTTGGCTCGCGTGCCCTGCCTCTGATGAA
ACCAATGTTGGTAGGGACATCTGACGATGTTGATGAATGCCAACAGCTCTGATGGTGGCG
CATGGGCCCATGTAACCGTGGCCTTAGCGTAGTTGGATAGTGCACGTGGTTCTCTTAATG
ACTGCTTAGCGCTGTACTCCATTATTGACGTTAGTAGTTTTTAATTACTTTTAAAGAACC
GCTTTTAAAATAAATGAGGATTATGGGCCAGGTGACTTGAGTGTTTAAGTAATATGAAAA
TGCGACAATATATAAAGGCAGTTTTTATACCAAAATGAGCAAAATATAATATATAATCTT
CTTCTTAGGGATGCCTCTAGGCATGAATGGAATGTGGCATTTCCTGAATTATTTTGAACA
GGTAAGAATCAGGAGAAAAGACAGTGGGAAGTAAATTTTAAGCCTATGATGGTGTAAGAG
TAGTGGACAGAAAGGATTTCTGAGAAATTATATGCTGAGGCTTTTAATTGGGGTATTGAA
ATTTACTTGACTGCACCAGATGATTCTTAATGTTATAAATTTTTCTTTTGTCTACATTGC
AGTTACGTGCCAAAGATGGATGAGCAACTGCTGAGGTGGGTTGCTGAAATGCTTGCACAA
TGGAAGGTTAGGTTCCTTGAACGTTGAAAGTAACTGACTGTGCCGCAATGATGACGTTTT
ATTTGCTACTCTTGACTGTCAGAATGACGAGAGTTATTACCACCATTACCCCAGCTGAGG
CACGCAGAATAGTGTTTTGAGGATACAGAAATTGTACCAAAGTTCACTTGATGCTGTTTA
TTCCTAGGTCCTAAACAAGCCTTCTTCAAGCCTAGGCATGAGCAAATAGGTGAGAAACAT
TTATATTCCATATTCACCCCCGATTTCTGTTATTTTAAGGGAATGCCAATAGCCGGAGCA
CTGTGCTTTAAATTCATTAGAGGTTTTTCCACTTATTCTTTTCCAACGTGTGTTTCTACT
CATTTTGTGATAGTTTACATTTAATGACTGGAAACTTAAAGGAAACAGACATAGTGATGG
TTGCATAGTTCAGCAGATTGAGTTGTGAAGATATGTTATTTGTCTGATGTGTCTGAGTTA
GTAAAACTGGTTTGATGTTAGCATAAATGAAATAGTACTAATTTGACTTTTCTCATTTTG
TAGGTACTAATTTAGCCTGAAGTTAGAAGGGTAAGTTAAAATTCTGCAAAGTTAAAGCTT
TAATATGGCAAATTTGAGATAATTGGCACAAATTGATTCTTGTGGTTTCAGTGTGGTGAT
ACACAGGAAGCAATCCTATCATGTAATATTTGAGATTGGAAAGCTAATTCAGTTTGTCCT
GAGTGCATTAGATGAGTGCCAAATTATTGTCCTATTTGTGGTCTATAAAAAAGCCTGTAT
GATGATAAGCAAATGCTTGACTTAACATGAAGGTCTTATTAGCTCTAACTGATTTCAGGC
ATTTCAGTTAGGCTTTAGGAGAGAAAACTGATACTTGGCTATTATAAAACCTCCCTTTCT
TAGGTGGACCTGAGTCTGACCTGTCTTGGCAAGTTTTATATTTGGTGAGTGTTGAGATTT
TCCTCACCATTTTCAGTGACCGTGGAATGCTTACTAGTGAACTGCTAGTTGTGACTTTGA
CACTCTTGGCAGGGTTTAAAATGATGGTGATCAAATGTCTGGCCTGAAATGAACATGTAG
AAAAATTTAATACTGAAGAACCCTGTAGTAAACAAGTCTTCAGAAGAATTTGATAATGCC
TAGCTTTTTAATGTAAGTTTTATTTGCTTTCTAGGTCCATGGTACACATTTTATATCCAT
GTTTATCCACTTAACAGCTTGCTTGGGTAAGGACATCAAAATAGTTTTATAAAGTACTAA
GCGATAATGCTGTTGATGATGGTTTTTTAAATTAAAAAATGGGAATCTCTCTGAAAGAGA
GTGAAGATGAATATTTAACTGAAACAGTATATCAAAATCTTAGAAATATACCTGTTGATA
CCTGTTACTAAATTTGACTAAATTTCTGCAGGTCTAGAGGCAAACTTGGCAGCAATGGAC
AGGACAGTTTGGAAAGCACAAGGTATAGTAGCAAGTTTTTGGTTTTTGTGTGTTAGAGCC
GATACAATGATGATAACATAGTTCAGCAGACTAAAAGTGATGAATAGTGCTAAGTCTTTC
GCTCCTATCTGATGTATCTGGCTGAAAGTTTATGTCCATAGAAAAGTCAATTTAGCCACT
CCCACAAAACGTTAAGGACTTTGGTTTATTATAGTGGTTTTTATACTAATGTCTTATTCT
TTACTCCAGTATTAGGAATTCACCTTTGTGGAGAGCACAGGTTAGTTCAAACCATTTTAT
GACCTATATGTTTTCATCTGATTTTTTTTTTTTTTTTAAGATTTATTTTTATTTATTTAA
TTCCCCTCCCCTCCCCCGGTTGTCTGTTTTCTGTGTCTTTTTGCTGCGTCTTATTTCTTC
GTCCGCTTCTGTTGTCGTCAGCGGCATGGGAAGTGTGGGCGGCTCCATTCCTCGGCAGGC
TGCTCCCTCCTTCGAGCTGGGTGGCTCTCCTTATGGGTGCACTCCTTGCGCGTGGGGCTC
CCCTACGCGGGGGACACCCGTGTGGCACGGCACTCCTTGCGCGCATCAGCACTGCGCATG
GGCCAGCTCCACACGGGTCAAGGAGGCCCGGGGCTTGAACCGCAGACCTCCCATGTGGTA
GAGGGACGCCCTAACCACTGGGCCAAAGTCCATTTCCCTCATCTGATGTTTTTAAAGTGA
CTTATGAAACTGGGAAAACTAAATAATAAATTATTTCCCTCTTCAAACAGGTAGATTTCA
TTTACCTGAAGGCTTCAAGGTGAGCTAAACTTAAGTAAATATAATAATTTGGAATGTAAC
CAGTGATGTAATGATTCTGCCAAATGAAGTAGAATGATATCACTCAAAACCGTTCCATAT
TGTTTCTGAGGTTACTTTACTTTAATGAGAGCATAACTGATAATTTTTACTGTGATTTAA
TGCACATTCTCTGCTTTTAGGATTTTCATGACAGCCCACCATGCAGCTCTTAATATTTGG
AAGGTGAGAATTTAAAATATCATCACTGTCCTTGTTCCAGAATACATGATGATCACACCC
CAACTTGAACTCTCTCACTGATTATGTGATGACGATAAAAGATCTGATATTCTGTGTAGC
CCACATAGCATTTTTTTTCTTATCCCTACATAGCATTTAAATAGAAATCTTAATATGTGA
TTAAAGTATTTGTATTTGGTTTTTGCAGACAGCTGGATTGGATACTCACAATACAAGAGT
ATAACAGTCTGAATTTTAATTTCTGTAAGGTCATCTGGAGTCTAATAAATTTCTGTAAAC
CTATCTGGAGTCTGCTTCAGTTATGTAATGGGATCAGGAGAGAAATTCAATGCTGTATTA
AGTGTAGAAATCTTTCTTCTCAGTCTTGGTACTTCAGTGCTTTATCCATCATGGGAGACC
ACCAGGTATTTGGTGACTAGAAAATGCACTAGGACAATTTTCATAGGTGTTTCATAGGAT
GTCTTCTGCTTGAAAATAGAATTTATCAGGGAATAAGCTACTTAACAGCATTTTGTTCTT
AATGCTGTATTTCATTAGTAGAAATAAGTGATCAGTCATAGATTTGCTTTAAATTTCTCT
GTGGGAACAAATTACTACCTATTGGCTAATAAAAATCCCCATGTCAGTGTTTATAACCTA
CATTCTTGATTTCTACAATACCTTTGTATACAGTGCAAGATAGAGGCTGAAAAAGTGCTA
GAGCCTTGGATGTCTTGTGTAGGAAAATGTGTTGAAAGAACACAGCTTTTCAAATCAGGG
CAGTCATAAGTCATTTAGGTATTAAATCTGGAAGTAGTAAATTGGGGTCTAATCCAAGGA
AGGGCTCTGACTTTCTTGAAACTACTGAGGGGATTTGGGCTGAGGACTGACAATCAGGTC
CACATTTAGAAAGGATAGGTTGATGGACAAGAATGTGAACAAGAAGGCATTCTGTGGTGC
TGGCACAGTATTGTCAAATTACCAGGTTTGGAAGTGAGAAAATGGATATACTTTTAAGGT
AGGTTTTTTCCAGGTGAAGAAACGGAAGCCTAGAAAAGTTTTTAACAGTCAGGGTTGCAT
AACTGGAGTAGTACAGCCAGGTGTTAAAGGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved