Dasypus_novemcinctus Locus Mono:51:SNORA51
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:51:SNORA51
Dasypus_novemcinctus
Mono:51:SNORA51
scaffold_17091
SNORA51
1001..1132
1935
TTAGCACTCTCAGGTCCCATCCTGCGCCTGGCAGGGGAGAAAGGTGGGCAGAGTGTCAT
TAGTCCCTCCAAGCAACTGCAGAAAATTTCAGCCTGCAGTTTAGATTACACCTGTACCCT
TGGCACCAACCCCACTCCCAGTATGGGAGAAAAGTGTATAGAATTTCAGAAGTTTCTTAG
GACAGCACAGTCAGTCTCAGTCTACATGGCTCAGATTACCTCCTGCACCCTCAGCTCCAA
CCCCACCCTGGTAGGGGAGAAAGGGAAGGAATTAGATGAATAACAACTGAAAAAAATCTG
ATTAACTAAATATGTGCTACTATAAAGTTCCAAAATAAGTTGAAACAAGTGTCAAAGTGT
TGCTTTAGCACAAAGCCAATCAACAGAAAGCTCTAGGTTAAAGAGAGAAACTAAGCCCAG
AATAAATATTTCAAGAACATAAGATGCTGAGACACCAGCAAAAAATTACAAGCCATACTG
AGAGACAGGAAGATATGGCTCAATCAATGGAAAAAATTAAACCTCCAGATGACACAGGAT
TTGAAACAACTAACCACAGTTCAAACAAGTCTTAATAAATTCAATGAGATGGCTAAAGAG
ATTAAGGAAACTAAGAAGGCAATGCATGAGCATAAAGAAGAAATTGAAAACATTCAAAGA
AAAATAACGGATCTTCTTGGAATGAAAGGCATGAGAAATGAAATAAAAAGTCACTGGCTT
ATAGCAGCAAATTTGAAGAGGCAGAAGAAAGGATCAGTGAACTTGAAGACAAGGTGTCTG
AAATTGAACAAACAAAATCAGATAGAGAAAAGTATAGAAAAAATGAAGAGGGTCTCAGAA
AACTGAGCAACAGCATGAAGTGCTCAAACATATGTGTCATCTGTGTCCCAGAAGGAGAAG
AGAAGGGAAAAGGTCTAGAAGGAATATTTGAGGTAATAAGGATAGAAAATTTCCCACATC
TTTTTAAAGGCATAGATATCTATGTCCAAGAAGCACAATGTGGCCTTCTGGTGCTTACCA
CAGGATGTGTTCTTGCATTGACTGTATAGAAAAAGGAGGCAGAGTGAGCTGGCCCCATAT
ACATCTCAGCCCAGACCTTGTGCCTGGTCTAAATTGTGAATGGGGAAACATGGAGGAAGA
AAAAGAGGACAATGTACTCCAATCCAAATTAACCCAAATAGATCTACTCCAAGACACTTA
CTAATGAGAATGTCAAATGCCAAAGATAAAGAGAGAGTTCTGAGAGCAGCAAGAGAAAAA
TGATTCATCATACACAAGGAATCCCCAATAAGATTTTTCATTAGAAACCATGGAGGCAAG
AAGGCAGTGGTATGATATATTTAAGATTCTGAAAGAGAAAAACTTCCAGCCAAGAATTTT
ATAACTTGCAAAATTGTCCTTCAAAAATGAGGGTGAGTTTAGAATATTCACAGATAAACA
GAAGCTGAGAGACTTCATCATCAAGAGACCAGCTTTACTAGAAACCCTAAAGGGAGTGCT
GCAGCCTGAAAGGAATAGACAGGAGAGAGAGATTTGGAAGAGAGTCTACAAAGGATGATC
ATTAGTAAAATTAAAAGTGTAAAAAGAGTAATGAAAATAAGATATGACATATAAAAACCA
AAGGACAAAAGGGTGAAATAAGTATAGGCTTTAAAGTAATAACATTGAGTGTCAATGGAT
TAAACTCCCCTATCAAAAGACATAAACAGGCAGAATGGATTAAAAAAATATGAGCTATCT
TTGTGCTACCTATGAGACACTCATCTTAGGCTGAAGGATACAAATAGGTTGAAAGTGAAA
GGCAGGAAAAGGATACTTCATATGTATAGTTGACAGAAAAGGGGCTGGTGTAGCTATACT
AATATTGGATAAAATAGATGTCAAAGTAAAGGTGTTATAAGAGACAAAGAATGACATTAT
ATATTATTAAAGGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved