Dasypus_novemcinctus Locus Mono:64:SNORA74
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:64:SNORA74
Dasypus_novemcinctus
Mono:64:SNORA74
scaffold_23578
SNORA74
1001..1202
2202
GAGTTTGCAGGTAAATATCCCTATTCCTTCAAACATTGACTACCTCCTATGTACCAGGC
CTGGTTGGTGTCCATCTATCTGGAAACAATTTGGAGGCAAAATCACTTATTTATTCCCAA
CAAATTCAGCCTCTGGGTAGGATTTTGGTGGCTATGGTCTGAAGGTATGTAGGTTTTCTA
AGTATCTGCATCATTCAGCCTTAGGAATTTATAGGGACAGGAAAGGCCTTAATTGAATAA
TACAAACTGTCAGAATCTGCCAGTAATTGGACTTTGGTTTGAAGTTACAGTATTGTCCTT
TGGCAGTTTGTTAAGTTTCATGAGGGAAAAGATAGTGTACTTTACTTATTCACTGCCAGA
CCCCAAGCACAGTGCTGGCACGTGGCAGGAACAACCAGAATGGTGAATGAGATAACTGAA
GTAATTGGAAAAAGATTCCGCTTTTCCTATTTGTGCAAAGGGTTTGGCAGTTTATTCTGG
GACCAGTGCTTCCATGCCCCTTTTACAGTAACATTAAATTCATAGTGTTATCTTTTTTTT
TTTTTTTTTTTTAAAGATTATTTATTTATTTATTTAATTTCCCCCCCTCCCCTGGTTGTC
TGTTCTTGGTGTCTATTTGCTGCGTCTTGTTTCTTTGTCCGCTTCTGTTGTCGTCAGCGG
CACGGGAAGTGTGGGCGGTGCCATTCCTGGGCAGGCTGCTCTTTCTTTTCACACTGGGCG
GCTTTCCTCAAGGGCGCACTCCTTGCGCGTGGGGCTCCCCCACGCGGGGGACACCCTTGC
GTGGCACGGCACTCCTTGCGCGCATCAGTGCTGCGCATGGCCAGCTCCACACGGGTCAAG
GAGGCCCGGGGTTTGAACCGCGGACCTCCCATATGGTAGACGGACGCCCTAACCACTGGG
CCAAAGTCCGTTTCCCTATAGTGTTATCTTTATCCATTCTTCTACCTGGGTTACCTGGGT
ATCTGAAACAAATAAGAATGGTAAAGCTGTTTCAGGAATTAACCAGCAGTTGTCAGCTTT
CCAGGCCAGTGTGATGCCTGTGATGGTGTTACACTGTTGGAAGAGGAAGCACTACCTTTA
CTGTGGTCTGGCCCCAAGCACTGTTTTGGTGATGAGGGCAAGTACCTATAGGGCAGTGTT
TTGCACCTCTGAGAGTGGAGTGGCTCCCTTTGTGGGCTTGGTCCTAGTCTGGGTGCAAAC
AGTTTTTTTGTGTGTTACATGTTAGAAAGGACTGTCTTAGAGACAGCCTGTAATAACTTT
TCCTCCTTGAATACTAGGTGCCTTGACCTGAGTAGGAAATCTGCTTCCATCAGAATCTCA
GATGTCGGACAGACCTGACCTGTACAACAAGATACGTATGTAGTTCTTTTGTCATATAGG
TCCTTACTAAGTTAGCTTCAGCCCAGATGGGTTTATACTGCATCATTCTAGGGCAGAGAT
CTGCAATCTTTCTGTGTGACCTTGGTGTCATGTCATCCAGGCCGGTAAAGTCAGAAAGTA
AATAAATTAGGCCATATGGTCCCTGTTGCAACTACTGTTTTAATGGAACACAACCATAGA
CCATATGACACCAAATGAGCATGGTTGGTTGGTGTTCCAATAAAACTTTATTTATTTGTG
GGGACTGAAATTGGAATTTCATAAAATTTTCAGTCAAAATTTTAAGGTTTAAGATGTGGG
GTATCAAATTCCTCTAAGCATGCAGGCTGTTTTTTCTGACCACTGTAGGATTACCTGGTG
TGCAAAGAGGGGTTTGAAAAGGGATAATTAACTTGCTGCTTGTGTGCATGTATTCATTGC
CCCAATAGGTTTCAATGGCTTAATCATGCAGTTAAAATAACTTTAATGGAATTTCCTACT
TGATAAATGAAGTTAATTAGTCACCTACTTATTCCTGTTGTCTTGATTTTTTTTTAAACC
AAAGAAATTTATTTCCTAGTGAGTCCTAAGTAGACGTGAAGTAAAATATTTCAGGGTGCC
TTTTTATTTGTTCCTTCCCTTTCTCATCCTTTTCCACTGCTATAATGAGAATTGGGATTG
GACTGGCTGAGTTACTGGATACTTAATGCTTCCTGCCATAAGTATCAATAAACACAAGCG
GCTCTCCAGTTCTTTGGCCAATTTCAGGTTCCTAGGCCTGTACCATAAAGAGGAAAAATA
TTTAAAGGAGGGCAGGGAACCCCTCTAAAATTTTTGGTATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved