Dasypus_novemcinctus Locus Mono:235:SNORA51
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:235:SNORA51
Dasypus_novemcinctus
Mono:235:SNORA51
scaffold_118367
SNORA51
1001..1121
1903
GGAGTCATACTTCCCAATTTTAAAGCTACAGTAATTAAAACACTATGATAGGGAAGCGT
CTGTGGCTCAATCAGTTGGGCTCCTGTCTACCATATGGGAGACCCTGGGTTCACGTACTC
CCATCTACCATATGGGAGACCCTGGGTTCACGTCCCGGGCCACCTTGTGAAGGCAAGCTC
GCCTGCAAGCCCCGCAGAGTGCTGCCCTGCCTGCAAGCGCCACAGAGAGCCAACTCAGCA
AGGTGATGCAACAAAAAGGGAGACAAGGAATAAGAAAAACACCAGAAAAGCATGCAGTGA
ATGGACACAAGCATACAACAAGCAAAAAGCCACAAAGGTGGAGTGGGGGAAACACTATGA
TACTGGCAAAATGATAGATATATAGAAAATGGAACAGAATTGAGAGTCCAGAAATGAACT
CACATTGATAGCCAACTAATATTTTAAAAGGGTGCCAAGTATTAAATGGGGAAAGAATAA
TCCCTTCAACAAATGGTGCTAGGAAAACTGAATATACATGTGCAAAAGAAGGAAGTTGGA
ACCTTACCTTATACCATATTCAAAATTTGACATGAAATGGATGAAAGACCTATACATTAA
AACTAGAACTATACATTAGACCTATACATTAAAACTAGAAGAAAACAGGGGAACCCTCAT
GACCATGGATTTGGCAATGATTTCTTAGATATGACACCAATGGCATGAACAACAAAAGAA
AAAATTACATAAATTGAACTTCATTAAAATTTAAAACTTCTGTGCATCAAAACATAATAT
CAAGGTCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAAAGGAG
GCAGAGTGAGCCAACCCCATATACACCTCAGCCCAGGCCTTGCACCTATGAATGGGGGAC
ATGGGAGAAAAAAAGAGATAATATCAATAAAGTGAAAATACATACTACAGAATGGGAGAA
AAGAGTTGCGAAGCATATAACTGATAAGTGTTTAATATCTAGAATATTTAAAGAACTTCT
ACAACTCAATAACAATAGCAAAAAATAAATAACCCAATTTAAAAATGGGGAAAGAACTTG
AGTAGACATTTCTTTAAAGATATACAAATGACCAATAAGCACATTAAAAAACTGGTCAAC
ATTCTTAGTCGTTAGGGAAATGCAATTCAAAACCAAAATGAGATATCACTTCACACCCAC
AAGAATGACTACACTTTGGCAATTCCTCAAAAGTTAAACAGAAAACATAAACTACATAAC
CCAGCAAATCCACTTCTAGTTATATACCTCAGAGATTAAAAGCAGGAATTCAGATTCTTG
TACACTAATGTACACAGCAGCAAAGGTGGAAGCAACCCAAGCATCCATCAACAGATGAAT
GGATCAACCAAATGTGGCACATACATGCAGTGGAATATTATTCAGCCATGAAAAAGAATG
ACGTTTTAATACACGCCAAGACATGGATTAACTTTGAAAATATTGTGTTAACTTAAATAA
GACAGACACAAAAGGAGAAGTATTATATGATCCCACTTATATCCAGGCAGATTCATAGAG
ACAGAAAGTAGACTAGAGGTTGCCAGGGACTGGTAGGCAGGGAAAATGGGGAGTTACTGC
TTAGTGGATTCAGCATTTCTGCTTGGGGAAATAAAAGGGTTTTGGTAATACATTGTGGTG
ATGGTACTGAATTGTACACTTAAATGGTGAAAACAGCAAATTTTCTGTTTTTTATATATG
CGTATGTCAACACAATTAAAAATGCATTGAAACAGAAAGTAACTTTGATTCCACATCTCA
CACAGTATACAAGCATTTACTCAAAATGTATTATAAACCTAAGTTTAAAAACTAAAACTG
TAAAATCTCCATTAGATAACACAGGTGAAAAATGTTCACATTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved