Dasypus_novemcinctus Locus Mono:221:SNORA44
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:221:SNORA44
Dasypus_novemcinctus
Mono:221:SNORA44
scaffold_107002
SNORA44
1001..1129
2129
TTTATGAATGTATGTAATAAATTACAGTAGTATTCATTTCATATCACATTACAGTTGTT
GCATATCTTGAAAAATCTCTTACACTCAGCCGTCCTTCAAAATTAGACCCGACGCTAGTT
GACTGTCATAAAGCTATCTGCCACTACATTCTGAGAAGGGTTCTGTGGTTTTCATCTGAC
TGGCAAAGGGGTCTCGTGGAACAGAAAAGCTTAAGAACCCCTGCATTACAGTGGAGGTTT
TGAGGAGAGGGAGAAGGAAAACTCTGTGTAATATGCGGGCATTTTGGGGACATTGGAATT
GTCCTGCCTGACATTGCCATGACAGATACAGGCCATTATATGTTTTGCAGTAACTTACAA
AATTCATGGGACAGAGTATGAACTATAATATAAACTACAATCCATGGCAGCAGTGCTTCA
ATATGCGTTCATTGATTGTAACAAGTGTACCACAGCAATGAAGGATGTTGTTAATGTAGG
AAGGTGTGGGAGGAGTAGGAAGTAGGGCCTATAATCCCCTATATATATATGTATGTATGT
ATGTATGTATATTTTAAAGACTTTTTGAATTTCTCTCTTCCTCCCTTGTGGTATGCATTT
GCTATCTGCTCTCTGTGTCCATTCATTTTGTGCTTGTCTTCCTTGTTTTTTTATTTTCTT
TACGAGGCACCAGGAACCAAACCTTGGGACCTCCCATGTGGAGGAGGTGTCCAATGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTTAAGATTTATTTTACAGCATGTTCCCAGGGTCT
CTGGCTGCTTGTGGCCACGTGATTGCCAACTGCATGCCAGAACAACCTGGAGAGACTCTG
ACAGCCCAGGTCAGCAGTACCCGCAGCTACCACTCAGCTTTCCCATGGTGTCTCAGGACC
CGGGCTTGGAGGCCCACGGCCAGGTGTTTCGATTTCACCTGTTTCGGCGTGTTCCCATTT
GTTCTGCAGGTTACCCCTGAGTTCCCGGTGTTAACAAGTCAGAAGACTCCAGCCTGTGGC
TGGAGCAGGGCTCAGATACCTAGAAAACCGTCCTCATCTGAGTGTGGACCTAGGTTTGGG
AAAGCACTGGGAAGAGGCAGGCTAAAGGCACCCGGCTGCTGTTAGGTGGAAATTGTGGCC
ACAACAAGCAGAGTCCTTTGCTTTTTGTTTAGTGCTTACATCCGTTGTGTCTGACACATT
GGTGACCAATGAAAGATTTACTCTGTGGAAAAAAAGATTTATTGATTTGTTTTATTTATC
CCTCCCCACCCCTCATTGTTTGCACCTTGCTGTGTCTGTTTGTCTTCTTTGTTTCTTTTA
GGAGGCACCATAAACTGAACCCGGGACCTCTAATGTTGGAGCAAGGTGCCTAATTGCTTA
AGGCATCTCTATCCCCTGCTTTGTTGTGTCTCTTGTTATGTTTTTCCTCTTGTGTCTCTT
GTTGCGTCAGCTCATCATGCCTGCCTGTCGTGCCAGTTTGCCGTTCTGCTTGTCCTCTCT
AGGAGGCACCAGGAACCTCTGCTCCCTGCTTTGTTGTGTCTCTCATTATGTTTTTCTTCT
TGCATCTCTGGTGTCATCTTACGTCAGCTTGCCATGCCTGCCAGTTGTGCCAACTCGCTC
TGTTCTTTAGAAGGCACCGGGAACTGAACCATGGACCTCCCATGTGGTCGGCGGGAGCCC
TGTTGCTTGAGCCGCACTGCTTACCCACCCCCCCACACATATTTTTTATGTAACATTTAT
GTAACCTAAAGTATCTTTTTAAAAGTTTTTTTAAAAGGTAATTTTTAAAAAATGAACCCC
TGTATTAAATGGAATTAATGAATACTACCTGCCAGGACCATTCATTAATTCCTCTCATAT
AACATTGAATACAATGACTTCCATACACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved