Dasypus_novemcinctus Locus Mono:194:SNORD102
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:194:SNORD102
Dasypus_novemcinctus
Mono:194:SNORD102
scaffold_86754
SNORD102
1001..1072
1291
CCAAAATGACAAACACAAAGGGAAAGAGGAGAGGGACCCGCTATATGTTTTCTAGGCCT
TTTAGAAAACATGGTAAGTAGTTTACTTTCTTTGAGAGCAAATATGACATATATTTGTAT
TTAATACATTTCTACTGTGCTGTGGCTCTTAGATTTTTTTTTTGAGGTACGGGTCCCAGG
GATTATACCTGAGGCCTTGTATGTGCGAAGCTGGTACCCAACCCCTGAACCACATGGTGG
CTCCTCTGAGTTGGTTCTTTTTAGGGGGCACTGGATACTGAACCTGAGACCTCCCGTGTG
GGAAGCAAATGGCATTAAATAACCAGCATCTACCTAAGTTATTTTGTAATAAAGCATGAT
TTTTATGTAGTGGTGGTGTTTGTTTTTTTTTTTCTATCTGGTTGCCTCCTCGTCTTTTTG
GTATGTCACTTCACCGAGTGGGGTCCAGCACCTCTTCGCACCGTGAGGGTCTGGGACGCC
TTTTTTCTTTTTCTTTTTCTTTTTTTTTTAAGGAGGGAGTCCCTGGGAACGATCCCGGGT
CCTCCATATGGTAAATGGGAGCTCAGTTGCTTGAGCCACAGCTGCTTCCCTTAGTGGTTT
CTTAAAACTAAATATTGGTACAGGATTAAACTTCACTTTAGGAGAGAGGTTGTATATTGA
CTATCAAAAAATTTTGCAGGAGTTGTTCCTTTGGCCACATATATGCGAATCTACAAGAAA
GGTGATATCGTAGACATAAAGGTAAATTTCTAAGTTGTGCAACTAACAGCAAAATAGCAA
GTTAGAATTATTGGATTCAATTTAGTATTAGAATTCAAAACTTGTGTATATTGTATCTTT
TTATCCTCCTAAATAAGGAAAACTTTCCTGAATAAGAGCGAAATGTAGAAAGAATTATTA
AAATTTTACTTTAAGGAACCAGACTTTTAAGTGCTATTCTAATGGAAACTTAAAAAATGG
CTCATTACCTGCTTGCTATTAAATGTATACTGGCAGTCAAGAGTTTGATGATGATTGTCT
TTTTGATTGCTTTAAAGCAATGTGAAAAACACATTTCACCGGCTCTGAAAGCTCTTGAAT
TGTCATTTAAAAATAGAGTTGAATATCTAAGTGTAATAAAAGCCCAGGATTTAAAAGAAG
GGGGAACAGCTGGTGTAACTTTTTTTTTTCCTTGCAGGGAATGGGCACTGTTCAAAAAGG
AATGCCCCACAAATGTTACCATGGCAAAACGGGAAGAGTCTACAATGTTACCCAGCATGC
TGTTGGTATAGTGGTAAACAAACAGGTTAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved