Dasypus_novemcinctus Locus Mono:332:SNORA32
snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus Mono:332:SNORA32
Dasypus_novemcinctus
Mono:332:SNORA32
scaffold_2879
SNORA32
1001..1127
2127
TTCTCATTCAAATTGCTCTCTTTCCAGTTTCTGTAATTGGCACTCACATTGTTTTGGCC
ACCTGTGCTTGAGTCAGCTTTAAGTCAGCACTTAGCAAAGGTATCCTGCTGGTTTTGTTC
TTGCTGTTGTTGTCCTTGTTATTTTCATTAATTGATTTTACTTCTGTCTTTTACATCTCA
GATCCTATCTCCAGGTATATTGACTCCTTCTTTGCTATGTTCCTTGGTTTGCTCTTTTTA
TTCCTCTTGTCATTATCTGCATTTGAGTCCTGGTTATCTCATTATTATTACAATTTTCTC
CTACCCAATCTTCCCGTTGATCACATCTTTCAATCTAACCTTCACATAACAAAATTAATC
TAACAAAAACTTTTCTAATTTTCTTTCCAAATAAACTTAATTTCTTTAACTGTAAAAGTT
ATTATTTTTAATACAAATTCTTATCAGCATTTGATCCTGTGTGTGCTTATTTGTCCTGTA
TGATGCTGATGACCATGAAATAACAAAACACTAATGTAGGGCAAACTGCTGACTGAGTAG
AATTTGATGGTTTTAGGTGGGAATATCATGATATTTACATTGCTGCGGCATTGGCTATCA
CTCTTTTGATACAAGAACATGTCTGAATGGCATTTTCTGCTAATATTTTTTTTAAAAGTC
TAACATATCTAGAGCAGAGGAAGAACACAGACTCCACTGAAAGAAATTCACTTCTACAGT
ATTGTTAGAGAGAAATGCTTGAGTGTAGTATTATGCCATTTTACAAGATAATGGCATAAT
ACTAATAAAGAAAGAACAATGAAAGAATAATGGCTATTCGTGATTAGTGATATACAAGGC
ATATGACAAGGCAACTGAGATAAACAGCAGCATCACAAATGCACAAAAAGGAAACTAGTT
AGAGTTCAAACTACTTCCTAGTTCAACTAAGCTGACTTAAACCTGGATCTATCCCCAGTC
TTGGTAGGCAATAAAGAGACATTGTTATTAAAGTACATTTTTGGTCATTACCAAAGCTTT
TAGAATGCAGTTTCGGATTTGCTGTGGAGTTGACCATAAAAAAAAAAAAAAATCCCCACT
GGGCTTTCTTTTTGCTACCTTGCTAGCATCAGTCTGTTGGGAACATTCAAAAAAAAAGTA
CATTTTATCTTTATTGTTCATTTTGCAGATTTTTTTTTTCTTTTTTAGAGAAGTTGTGCA
TTATAGAGCAATCATGCATAAAATAAAGGATTCTCATATACCACCCCCACCAACAACACC
TTGCATTGGTGTGAACATTTGTTACAATTGAGGATAACACATTTTTATAATTGTTCTATT
AATTAAAGTATATGTTTAATTTAGGATCAGTATGTGTACAGTGTAGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGACTTCATACTATCTTATTACTGAATAATATTCTGTGTATGTATATGCTGCAATT
TGTTTATCCATTTATTGGTTGATGGACACTTGCGTTGCTTCCATCTTTGTCAATTACGAA
TAATGCCACTATAAACATTGGTGTGCAAATATCTGTTCAAGTCTCTGCTTTCAATTCTTT
TGGGTATAGACCTAGTAGTAGGATTGCCAGGTCATGTGGTAATTCTATATTTAGCTTTCT
GAGGAACCAGCAAACTGTTTTCACAGCTACTGTACCATTTTGCATCTTTATAGTAAAAAT
TACATAATTGAAATAACTGCATGTATACATTTTCTTTTTTAATGAATACTTTTGTTGTCC
TCCTACATTCTCTGGTTAAAGATGCTTTACAGGATATGGATATCTAGATAAGATAGATTT
TACCTGACACCAAAGCCAACACTTTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved