Danio_rerio Locus wu:fa28a02
snOPY snoRNA Orthological Gene Database
Danio_rerio wu:fa28a02
Danio_rerio
wu:fa28a02
1
SNORD58, SNORD58, SNORA31, SNORD58, SNORA31
2229..2299, 2809..2880, 3541..3674, 5794..5864, 6185..6315
8270
ATGAATATGGTCTTCTTTTACAGAAAACCCTCCCAATTTTAAGATGTAGGCCTATATGT
CGTAGGGCTGGGCGATTTGGCAAAAAAAAATAAAAAATCTAGATTTTTTTTCATAAAGTT
TGACCGATTCACGATTTCGATTTTTTTTTTCAACATGACTGAAGTAACATTATCTTTATA
AGTAAATTGAAAAACTATCTGGTTAAGGACCATTGTGTTTTTAATGACCATGCCATACAT
AAATTGTTTCAATTAAGTTTATTTCGTTTTTATTTATTTATTTATTTATTTATTTATTTA
TTTATTTATTTATTTATTTATTTATTTATTTATTTTGTTGTTGCTTGTAGCAAGGATGAA
CACAAAAATCTTTTAACAGAATATATGAATAATAAAAGAATGATAGGCTGTTCCAAGCCT
ATCAATAGCTTATCAATAGCCATAAATACGCAAGACATACTCTTTTTAAAAAGCCAACTG
CAGAAAAGCCAACCACATCGCGGCAACCGCAGGCACTTTTTCCGAAGTTCAGCTCTTCTT
TTTTGCACTTGATTATTATGCGTTTAAATGTAAAAAAAAAAAAATCAATGATGAATAGGC
CTACAAGAGTGGTGTGTGTGTGTGTGTGTTCTTTGATATGCTTATTTTTTAATTATTTGA
AATTGTCAGCAGTTGGAAAAAACTGTCGGTAAATGTTGTCAGAAAGTTTTCATGTCTTGG
CAACTAAATTCATAAAATTCCAAACACATATGGCAAACCATTTCAGATGAACTTAAACTC
AAACAAAGCTCAAGTAAAAATGGTTATTTATTGGAAAATGAATTTAGGCCAGTGAGGATT
TGTTTTAGAACTGGTAAATTTCTGAAAAAAAAGTGTTTCTTTGGTTCTGATTTAGTGTAT
TTTTAATATATAATATAAAATTCACTGTTCTGATACGTTTTTTTACAAAGTATGTTTGTT
TTTTATTAATTGGAATAAATATTTAAAGATTAATAATTTGTAATCTATTTTAGGAAACTG
TCTATGAAACGGAGGAGATTTGATGTCACACCGTTAGAGGGCGCGCGTGACTCTCAGCGC
ATATATAAGATGTTCAATCCACGCGCCGGCCTTTTCAGCTGAGTCCACGATCAGGTCACA
GCCAGCGCTGTTCGCCTTCTGATATCCCCAGACACAATCCAACAAAATGATCATCTACAA
GGACATCATCACTGGTAAGAATTACGTCCAACTCGAAGTAACACATCAAAATGTTAAGTT
TTTGTTTATATTTTTGCCATCAAGTGTTCCTGGGTTGTTTTAAAGGAACTGTGTTTTCCC
GGCTCAACTGCGGCCTAACTGTTGAGCGCAGTTAGCATTGGGGCTAACCAGCTGTAAAAC
TATGTACACGTTGTTTTAATGTCTACCATCTCTTTTTATATTATATTTTGATAAATGAAT
CATTTTATTTCCAAAAGTGAGGGTATTAAACAGTTCGGTTATATTTAAGAAATACTGGCG
GTAATTTGAAGTGCTAGCAGCTTGCTTAAAACGCCGGTCGGCCGGTAACGTTATAGGGCT
CCTCTGAAGTTGTGCGTTTAGTTGCTTTCGCAGTCACGCTGCTCGGGTACCATGTTTAAT
TCCACAAGCAATGTGTTTAAAAATTGTTTTAAACAACAGAAACTATAATATTGAATACGC
CGGTGGAAGCTTTTCTCCATGTTCACAAATGGTTTTGGGATGACGAAATGAGCGCTAAAC
AGGGCGTGTTGCTCGTCTAGGCCAGTTCTGTACTTTAACTGAACGTACTCATTACTCGCT
AAGCTTCTCAGAGCCTTTTTTTAAGGAAAGGATGTTTCATCACACCCTGCTCTTTCACTT
GGCTTTGTGTGCTTTGTTTAATTAATGAGAGCAACGCGTTTTAATGGATACGTCTAGTAT
CACACAATAAATTGACGAATTTTTAAAATAAATTATAAACCAACTAACTTAAATTAGTAA
TCATCAAGCTTAAACAAGCAAACTATTTAACTTTGTGTAACTGAGTTTTTCAGGATATAG
TCAATATTTAATTTACACGTGTTTAAAGTTATTCTGTGGTGTATTTTACACACACTAGGG
TGTGACGTATCAGAGGAAACTTCCAGAACTATCTGTCATTGATTTTATTTTCAGGTTTGG
AAACATTCCAGTAGACACTACTGATAGGCATAAGAAACAAAGTTTTGAAATGCTAGCCCA
CAAAAGTACGTACAGTGATGACATTCTTAGGACACCTTTGGAGGATATGACCAATGAAAA
GAAAACATGTTCTGAGTACGTAACTTTGATGGGCTGTTGCAAAATAGAGGTATATAATAG
AGGAATAAAAACAGAGGAATATTCGGTCTTAATTAGCATTCAAGTGTGACTTCAAAACAA
CATTAACACTATCTAATCGACTGTGAACAATGTTGTACCTTGATAGTCATTGGCTGCTAA
TATGGTTTCTCCATTTAGAATTTGCCAAGAATACTTTGATATTATGTTTTTACAAAGAAA
GTCCGAATGTGTGAATGTAAAACCAACTTTACCTTAATTGTTGCAAAGACATTTTATCTT
ATCCCGTTTTCATAGCCAGCATGGGAAATGGCAAATATTGAGCTAACTGTAAAAGTGCTG
TTGTTGTTTTTCCACAGGGGATGAGATGTTCTCAGACATCTACAAAATCAAAGAGTCTGA
GAATGGAATGATGCTTGAAGTGGAGGGAAAGGTAAATGGTTCTTTTACACTAATATATAT
CCATTTATTTATTTTTAAATCGTTGTCAAGTGACTGCCCTCTTATGAACGTACGATGATG
ACAATCTTAGGACACCTTTGGAGGTTATGGCCAGTGAGAAAAACAACACTTTCTGAGTGC
GTGTCTTTGGGCAGACTTTTTTTTTTTTTTGATATCCTAATTTTTTTGGATCAGTACTGG
TGTTATTAGGAATGGTTTATTTTACAATTTTCTATCAAACAGTTCTTTTTGCCATGAACA
AGTGACATCAGCTTAATTTTTTTCTTTCTTTTTTTCCTCAGATGATCACCAGAGCAGAAG
GAGACATTGATGATGCCCTGATTGGTGGCAATGCGTCAGCAGAAGTTGCGGATGAGGGCT
GTGACAGCACTTCTGTCAGCGGTGTGGACATAGTCCTCAACCACAAACTTCAGGAGACCT
CCTACGACAAGAAGTCTTACACAGCCTACATCAAAGACTACATGAAGGCGTGAGTATGAT
GTCAACAGGCATGAAATCGCTTGTGAAGAGCATGTTGTACCTTGCAACAGCAGTCTTGTT
TAACAGCAAATATAAAGGCCCCCATGTGCTTGAAGCAAAAATGGTGTGATGTCATTTCAA
ATAAATCAGTCAATAGTGTTATGATATAAAATATTAATATTTTAATAAATCACATTTCAG
TTTCCAGCATGAGAGGCGTCAGGATGTTCAATACCTCAGAGGATGAATGGAAAAACCATT
TTGCTGTCAGTATATTAGGGCCTGTATACTGCTAATATTCCAATCATTTATAATAAAGCT
TTTGCATCATTGACAGCTCAGAGTCTTGTATTGTGGCCACCTGGGTTTCAATATGTTACG
ATGCAAAATGAAAGGTCCCTGCGCTTTCTGCTTGCCCCATGAGTGGCATGTAAGATTGAA
TTTGGGACTACAAATGTTCTTAACTCTACTTTGATTTTTCAATTCTATAAAGCCTTGTGG
TGTACTCACTTTTTGTTTTTGTTTATTTACATTACAGAGTTAAGGCCAAGTTGCAGGAAA
GTGCACCTAATAGGGTAGATCCCTTTATGGCTAACGCACCGGCTGAGGTCAAGAAAATCC
TAGGCAACATCAAAAACTTTCAGGTAGGTTACAGTGACCGCTGAAAGGGTCGGTGTGTCT
TATCATGCAGATAGATGTAACATCATTTTCTATTAATTAATTTAGAATCAGTATTGTTGG
GAAATTGATTTATTTCATTTACTAATTTTAAATTAAGTTTAACAATGATCACAATTATAT
CATTTGTATGTGCTTTAAAGCCTGTGACTGTACACATTTCAAGTTAGTTTAAAGCATTTA
GGCATAGGAAATTAATTTTAGTAACTTCAAGCAACATTAATTGTTAATTTGTAGCATTTA
TGCAATGAAGATTATACAGTTATTTAATAGCCCGTTTCCACTGAGTGGTTCGGTTTGGTA
CACTTTTTATGGCCGTTGTACCCAATATGGCACTGTCAAAAGCGTACCAAACCGCACCGT
AACACTTTTTCGGCACCCTTTCGAAAGGGTCCCAAACGGGAGAAAGAGTACCAAAACGCG
CAGCTGAACGCTGATTGGTTACAGAGATGCGTCACGAGCTTGTAAAGCTACACAGAATGT
ACAAGGAACAGCCATGTTTTTTTTTTTAAATACAAAGGCAAGACATTACATGGAAATACT
ATATGCATATAATAACCAGCCATGGATGACCCTAGCTCAAACAAACCTTGCTGTCATCTC
TGTGAACAGACACAAAGCCAAGAAGAAAAATCTGCCGTGTCCTGTTGTTTTACGAGCCCG
TCTAAAATTGCGAGCGGTATTTGCTTTCTTCCGGGAGCTCACGATCGCGTCTATGTTTGA
TATAACAAACTTCTTGAGTCGTTTTGATAATGGAGTGTGATTATTGAAGTGTCTCCATCA
TCTGATCCATTCAGGGAAAAAAGACAAGTGCAAAATGAAGCGAGAGTGAAACGGGGGGGG
GGGGGGGGGGGGGGGGGAAGAGAAGCCGTCAAAACACAGGAGCAAAATTGTTTTAGCAAC
CTGAATCATGAACAAATTGCCATGTTTATCTTCGTCTTTTAGACTATTATGAACCGAGAA
TGACAAAAATACTCTCTAACAGAGCTTACATGTGCTGCTGAAGATTACAGACACAGATAA
GAGGTTTGCGCTGACTGTGCGCTATGTTGCGTGTGTTGTAGAACTCTAAGTACTAAATGT
TTGCTCTGTAATGAATAATATATCTGAGTCTGTAAGAGGCTGTATGTGTTCATATATGTT
GCATAAATGTATTTATTTAATTTAATTAGTGCGAAATAGGCTACTGTAACGTCTGTGTCA
TTGATATGCAGTTATAATCAACTCATGTTCATAGAAAACTTGGTAAAACATTTATAAACC
AGTATTTGTGTATAAAGCATCTGTTTTGTGAGAAGTGCTGCTCATTATGATATGTGAACG
ACCTGTACAGCTTTACTGTAGACATTAATTCGAGCGAGCATGACGTCGACTTAAACTTTG
TCATACACTACCATGCCCACCAAAAGGGTACCCTTTGTGATTGAAATGCAAGCCTGATAA
AGGTGACCCGTACCGACCCGAACCGTACTGTACCAGTCAGTAGAAACGAGGCATAATTAA
CATTATTCGGTTTGTGTGCCTAAATACTGTTCAACTACGATTAAACCATGCATTTATTTC
TTTTTTAGTTTTGCTTTATTTATCATTGCTTGTGATTTTATTACTTATGCAGACGCTTTC
CAATTAAAAATCATCCAAATACTGTCCTAAAAAATTCTTTTTTTGAAATACAGCTATTCA
TACTCCATATCGCAGAAAAATGAAATTTTGCAATGCGAGTTTCCAATATTGTGCAGTCCT
AATTGTAAAATAGCACTAGTTTCTAGCATTTTATTTTCTCCATTTTTCATAAATATTCTC
GTTTGTGATTTTGCTTCAGTAGGGTTTACTTGAATCCTTCTAAAGGAGATCCGATACATT
TGAGAAGTTTATAAATAACAGCCCTCTAAAAGACGTACAGTGATGACATTCTTAGGACAC
CTTTGGAGGTTATGACTAATGAAAAGAAAACATGTTCTGAGTACTTGTCTTTGGGCTGTA
GCAGACTTAAAAAAATAAAAAAAATAAAAATATTTGGTTGTAGAAATTGGCATTGAGAAC
AATGAAAGAAAGAGGACCTCTTCACATGTAATGGAGCTCTTAAGATATAATAGTTTTTTT
TCCATCTTGCAGTTTTTCACTGGTGAATCCATGAACCCTGATGGCATGATCGGTCTCCTT
GACTTTCGTGAGGATGGAGTCACACCATACATGATCTTCTTCAAGGATGGTCTTGAGATT
GAAAAATGCGTAAGTTTCCTTTTCCTTTTTTTTTTTTAACACTTCAATGAATTAAATAGT
TTAGTGGGCATCCACTGATAGGCCTGTTGCCTTGGTTTGTGGCCTCTGGTTTGCACAAGG
ATGCAACAGTAATATTCCTCAATATATCTGTCCATCTGAATGGTGGCTGGAAAAGTCTAA
TCTGAGGAGAATAGGACATTTTAGTATCTGCATGAAAAGATGCTTTGCTGCTGCTCAAGT
GCTTGGTGGCTTGTAATGCTGTCAGTCTTGAAGCAATGCTTAATCCTTTTGTTTTCTTCC
TTCCTATAGTAAACGTCCCACGCTTCTACAAATCACCCCTCAAACTCTGGCCTCTGCTTG
ATGGTTTGGCCCGTGGATTAAACCAGTCATTCCCCCTCATCCTTTCCATCAGGACCAGAG
GCTCTTTTAACTTCACGAGGCCACTGTTTTCATTTCTTGATTGGCTTATGTCCGTCTACA
GCAAGAAGACGCGAACGTTCCCTTCATGAAATTTAAAAACAGGACTTTTAGCAAGCCAAG
CCACAACGCGCAGAGATTGTGGTCAAGAAACTGAGTCATTTTTGGGGTTCTATTTTATGT
CTTGGTCTTCATGGAAGTGAAGTTGACTGCTGGCTTCTCATTTGCTGTGCATGTCGGCTT
CTCATTTCAGCAGATGTACAGTTGTAATTTCCCCCTTTCCATCACAGGATTGTATAGGAT
TTCTCAGCACCGTTATTGAATAAAATCAAGCTGCTGGCTTATTCAAGTATTGCCTTGTTT
TAACTTTCTAGCATGTTTTTGGAGTTTGAACGCTTCATATACAAAAGTGATTTTTTTTTT
TTTTTTGTTGGTCAAGGGTCACAAAGATAGGAGTAAGAATTCAAGGAGAAATGTCGAGAT
GAGCTGCACTACTTTAAAGAAGCAGGATGGTTTGTTAGCTGCTCAAATTTGACTGTATAA
GGACAAATGAATTTAAACATGTATTAATTAAACCAACGTTACAAAATACAAGTTTTGTTA
AATGAACAGGCACTGTCTAAAAAAGGAATGGGAGGAATATAATGTGAATCCGTTTTAAAC
CAGCAATTGGAAAAAAAAAATGCATTACACTGTACATGCAAATTATTAGCTGGAGATTAA
CTTTCATAGCAAATGTAACATTTAATTTGTTGAAATAGCTCTTTGTCAAAGGGGGTAAAA
ACTTAATCGAAAGCTAATTTTATATTCTGTTTACTCGAAGAATGGTACCATTTTGTTGTA
TGGAATTGGATAAGATAATCAGAACCTTAATCTAATAGGTCTTGTGGGGAACATGAATTA
AAGAAGATAAATTTATATATTAACCCCATATTTTAATCAAAATAACAAACATCTAACTTA
CTGTTTACTTGTAAGATAATGAAAAGCAAATGTTCAAAACACGGTTCAATAAAATACTGA
TGTATATCAATGCTGTTAATTTACACTGTCAAGCAATTCAAAATTGTGTTAACCTGCTGT
AACTTAAAGCCTAAATTTACTAAATGTTAAGAATTATGAACATAAATCATTTTTTAAGGC
ATTGGGTTTACTTTGGAGTTAACTAATCATTTTATAAACGAATTAACTCCCCTTAAGTCA
ATTACTTGTTTTTAACATTGTGCATGAAACAATTCACACATTCATAAATCCCTTTGTTAT
AAAAAGACAAAATGCTGACATAAAACAAAATGTCATCATGATTCTCCAGAAATATAAAAT
CAGTTCAATTGTTTTGATGAAAATGGCTGAAACTCAGAGGAAATGATAATTATTTTGTAC
AAAACCTTTATTTCAAGAACATTTACTGAAGTTAAATAGTATACAAAATAACTGCATTTC
AATTAGAAAACCAAATCAGAATATTTTACTTAACTTTTACTTAAAATTCTGACATCACCT
TCTCGTTATACACCAATTGCTGCTATATAATGCGTGTTTTCCCTCAGTTCTGATTGAACA
ATTCCATTTCTCAATAAAACATCTTAGCGTTGTAAAACATAACATGAGTTTCAGATGCAG
CTCTAAAAACAACAGAAGAATCCTTGAAATAATCCAGAAATAACATTTCAGTCATTCTGA
GTCCAAACACATGTAAGCAGGTGATCTTGAAGAGGATCAGTCACTCTTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1012..1213, 2657..2730, 3041..3228, 3757..3862, 6012..6128, 6429..6880
1186..1213, 2657..2730, 3041..3228, 3757..3862, 6012..6128, 6429..6431
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved