Danio_rerio Locus Mono:34:snR50
snOPY snoRNA Orthological Gene Database
Danio_rerio Mono:34:snR50
Danio_rerio
Mono:34:snR50
12
snR50
1001..1090
2090
GAAGTATAAAATCTCTTTTCACGTCATTAATCTCTGCATTTTTGGTAAGTGAATTGTAA
GGAAATATAGTAGACAGTAAAGCAATATTCTTTACTGATATACAGTTTTAGGATATTTTA
GCTCAGTGATGTTTTCATGACAGTTGAGTCCTCTATTTGCATTGAAAAAAAACATAAATC
AAATATCAAACATATACAGTTAAAGTTAGAATTATGAGCCCCTCTGAATTATTAGCCCCC
TTGTTAATATTTTCCCCAATTTCTGTTTAACAGAGATTTTTTTCAACATTTCTAAACATA
ATGGTTTTAATAACTCATTTCTAATAACCGATTTATTTTAACTTTGCCATGATGACAGTA
AATAATATTTGACTAGATATTTTTCAAGACACTTCTATTCAGCTTAAAGTGGCATTTAAA
GGCTTAAATAGGTTAATTAGAATAACTAGGCAGGTTAAGGTAATTAAGCAAGTTATTGTA
TAACGGTTTGTTCTATAGACAATAAAAAATATATATATATATATATATCTTAAAGGGGCT
AATAATTTTGACCTTAAAATGGTTTTTAAAAATTAAAAACTGCTTTTATTCTAGCGGAAA
TAAAACAAATAAGACTTTCTCCAGAAGAAAAAATATTATCAGACATACTGTGAAAATTTC
CTTGCTCTGTTAAATATCATTGGAAAATATTTTTAAAAATTCAGGGCGGCTAATAATTCT
GACTTCAACTGTATATAATGAACTTAAAGTTCTGTAAATATAATTTCTTGCTTCCTTTTT
GGATGAGAAATGACACAGACATGGTTTACAACGATTCTACGCAAACAATACCCAAATAAC
CCAGGTTTTACCCACAAAATAAACTTGTTTTGGTTTGTTGCAGTATTCAAATATGTAATT
TTACAGTATAAAATATGTATACAGATGTACCAATTAACCAATCAAGGTGAAAGGATATGA
ATAATTTCCTCAGACCGACCAATCAACAACTTCAACATAGCGAATATGAAAAAGAAGCAG
CAAAGATATAAGAGAACTTTTATGTTTGAATCAAACAACATAACGATTACAGGCAAATCA
GCAGTGTTATCCATTCTGTATACAGTGGTCACAAGACAAAAAACAAAAACAAACAAACAA
AAAACAAATACACGCGCGCATACACACATTCACTCATACCCATTCATCATCATCATCATC
TCCACCTTACAGAAATTATACAAGAATAAAACCAGAAGCCCAAAAGCAAAAGCAACAGAC
CCTCCCGCCTGTGGAAAGCAAAGCAGCGTGGGTTTTGTAGTTTGTCTTAATGTAGAAGAT
TGTTTTTTTGTCTTTTCTTTTTTATAGAGAGAGAGGCACAAAATCAGGCTTCCGAGTCAC
AGTGAGGCTTTGAAATAAGTGTCAGCTACGTGTGTTCAGACTTTCATGTACACACACACA
CACACACACACAGACAAAATAAAGAAAAAGAAAAAAACGTTCGCGCTTCCACCACACGCT
CACCTTAAAATTCAACACAAATCGTCAAGTTTCCAATGAGAAAAAACAGCAGTTACAGCA
CATACAGAAACTGCAGAACACCTCATTACTGTTAATACATATGCACTGTGTATAATAATA
ATAATAATAATAATTAATAATAATAATTTCCAGTTGGATTGCAATTGAAAGAGTGAGAAT
TTAAATTATTTTTTTCTCTCTTTTTGATTGGCTCAGAACAGAGAGGTCTAGACGTAGCCA
ACAGACTTAGATACCCAAAATAACCTTGGTATAGACAAGTAGCATATAAAGCACACACAA
GCGCACACTCATTTGACTCATTCAGTTCAATGGAGGGCATTAAAAATAATAATAATAATA
TAATAATAATAATGCAGTGTTCGCTACCAAGCACTGCGCTCTTTCACTTCTGATTCAGGA
ACAGTTCTGACTTCCTAAATCCTGGCCCTCGCTGTTGAGAAAAACTGATCTGAGATCAGC
CTTCAGTGACACATATGCAAAATTCAGAACAAACAAACAAACAAAAGGAAAAAAAGATGC
TCCATTCATCTGTTTTAATAACAGCCAACACAGAATATAGTCCTCACGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_007123.6
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved