Danio_rerio Locus Mono:5:SNORA62
snOPY snoRNA Orthological Gene Database
Danio_rerio Mono:5:SNORA62
Danio_rerio
Mono:5:SNORA62
3
SNORA62
1001..1136
2136
TAAGTAAGTAGGCCTTGTATGTTGATTAAATGATTGTGTCATATAATGTAAGTTTAACA
ATTCTTCCCATGTGACACAATAAGGTATATGCAGAGCTAGTCATTTCCCCATACTGATAA
ACTTACCTGTTATTGTGAACTTTTTTTTTTTTCTCCATTTGATAAGGTTCCTTTTACAGC
ATCTATGTTGTAATGTCATTAAAATACATTCAGTTGAATAAACTTTGGCATTCATTTGGT
TGCTCAAGCGTAAAACGAGACAAAGTCGTTTACTCGCACGCGCCCGTGAGAATCGGCAGG
CTAAGTTAGCGTAGAAGTTCCGTTTAAATATACTGGGTTAAAATAAATGCTCATATTATA
AACACATGGCGGGGGGAACTGTAATTTAATGCAGTTCTTCTTGTACAATACGAGACCCAC
GTTATACCGAATATCACTCAAGTCGTGGAGATTGCTGATTTATAAAGAAAACATACCCTA
AACGCGCCGGTTTTTGCATTGGCATACAGCTTGCCGGAAGCGCTTAACCCAGGTTACTCG
CAAGTTAAAAGTCCTATTAGCATGCTTGGGCATATACCCTATTTAGACTTCATTTTAAGA
CTTTTACCCTTGGTTTGCTTGTATATGGTCTACTTTATGTAAAATTAAATACTTCAACGT
TAACAGACTAATTTTCCAAACTGAGGTGTGATTTTTGAGGTAAAGTTGGTGATAAGAACA
CATTCAGACTTTCTCCTTGATATAATTTCAGAAATTATTTACCAATTCTGAATCGTGACC
TCATATTAGCATCTAATGGCTAAGTACAGCAGTGTTCACAGCTAATCAAATAATACTAAT
GTTGTTTTAAAGTTATACTTTACTGCAATTTCAGTTTGAATATTCAAAGTAGTGTGATAA
ACAATATAGGGAGTGTTAATGCAGTTGCGTGAATCAAAAACCAACTTTTCTTCAGTTGGG
ATTTGGTATATTTGCCTCCATTTTAACTCCTAAATTGTAAAGTTGCACACAGTTAGAGCC
CTGCGCTGCTGGCGGTGCATTGTGGGGTGTAGGATGTGTGCTAAAACACTGCAGGGTCTC
TGATCTCTTCTTTCTGTTCTTCATGAGAGCTGAGAAAATGAAGATCCTGCCACAAATTTA
TTTTAAGAGTTTCTTTGTGGTGTTAATGTTTTTCAGAGTGCTTCATTCTCTTATTTCTGT
TGATTTGCAGGTTAAAGAAGAGCAAGTTTCATCTAAACGCTGACGACAAAGATTTTTTTT
ATTTATTTTTACCAGAAAGTGAAGAAATCATTTTAATGAGGGTTTGTTAGTTAAACTTCT
GAGCTTCAAACACACTTTACCAAATAAAATGCTATACTAAACTGATTTGAGCATCTTGTC
CATTTTTTTTTTGTTTGCTAATCCACAGGTGTCAAACTCCGTTCCAAAAGCGCCGCAGCT
CTGCAAAGTTTAGTTCCAACCCTAATTAAACACACCTAATCAAACTAATTGAGTCCTTCA
GGCTTGTTTGAAACCTACAGGTAAGTGGGTTGGAACTAAACTGTGCAAGGCTTCAGCCCT
CCAGGATTTGAGTTTGACACCCCTGTCTAATCTATGATGTTTATACATTTTTAAATTGAA
CCAAGTTCAAAACCTATGCGGTGTAAAATGTTGCTGAGTTTGTCCTTTTTCAGGCTGTCC
ATGGGGTCTTAAAGTATTAAGTGGATAAATCAATCTAGATAAATTTAAAGCCCTTAAAGT
ATTAGTCTTAAATGCTATTTTGCAAGGTAATAACGTTTATATAATTTGATTATGCAATGT
ATGGTTATGCTCAAGTCTGCTAGATTTAAATCTGTAAATATCAGGATGCTGTGTAGTTAA
TGAAATCTATAAAATCCTGCTAGATTTGGCATCATGCTTTTGTTTACTGCAGTAATCATA
GTAGCACCATTATTTCTGCAGTTCTATAGACGCCAACCTGCTGAATAAGCTAGATTTAAT
ATATTGTTGTTCAGTAAATAATGTTTTGGATTGCATTCTTACATTTTAATATGTAGTAAA
TATACTCCAAGTTAATCTTGCCAGTGTTTCTGGTTAACCTAAAATGGCTATAATATCTTA
ATGTATGGAAAGTCTTGAAGATCTTTAAAATGAATTG
  Untranslated Region
  Coding Sequence
  snoRNA
6150962..6153097
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved